Altica subplicata

LeConte, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records45

Data sources8

Biological traits0

DNA specimens14

eDNA detections16

Sources8 archives

Databases and archives Altica subplicata's data was compiled from.

Animal Diversity WebUniv. of Michigan MZspecies account↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADWarticle

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Altica subplicata has an oblong, oval body shape. The body is a dark metallic blue color, sometimes with deep violet reflections. Antennae and legs are the same color as the body. Larvae of A. subplicata are deeply pigmented. Females of this species tend to be larger than males. The elytra are low and weakly developed. The frontal tubercles are flat, and very finely alataceous and well defined posteriorly by post ocular sulci. It has a well defined coronal suture between the eyes, though the eyes are not prominent. The inner pair of setae are distinctly shorter than others. Willow leaf beetles have a quadrate pronotum with a deep transverse groove throughout. A. subplicata is distinguished from other low costate species as having a dull elytron surface with a deeper microsculpture.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica subplicata has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

31Tmostly conserved

133Tmostly conserved

AACTTTATATTTTCTATTTGGAATTTGGGCTGGTATAATTGGTACCTCCATAAGACTTTTAATTCGTACCGAACTAGGAAGACCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica chamaeneriisame genus4.7%Altica brevicollissame genus4.7%Altica lythrisame genus4.8%Altica aenescenssame genus5.0%Altica ampelophagasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Altica subplicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type45 records

Wild obs. + sensor1

Museum / vouchered44

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 8>10 km 34

43 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	30
Espace pour la vielocation not on record	6
Cambridge, US	4
Denver, US	3

4 institutions · 43 of 44 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Altica subplicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

Field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 15.8–23.4

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 21.7–25.9

Min temp (night)19.9 °C 11.4–21.7

Precipitation90.5 mm/mo 83.6–96.2

Air humidity59.4 % 56.2–59.5

Moisture balance-88.3 mm/mo -97.2–-40.6

Vapour deficit1,086 Pa 793–1,165

Wind speed5.40 m/s 4.10–6.10

Cloud cover39.2 % 36.8–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)