Altica oleracea

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records3 959

Data sources7

Biological traits2

DNA specimens78

eDNA detections136

Sources7 archives

Databases and archives Altica oleracea's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI136 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 959 records

Environmental DNA4 datasets · 13 countries136 detections

DNA & barcodingBOLD78 specimens

Genome at a glanceGoaT2n = 24

01Narrative

Altica oleracea is a species of leaf beetle belonging to the family Chrysomelidae, subfamily Galerucinae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica oleracea has left across the world's sequence archives.

At a glance

DNA specimens78

BINs2

Marker genes2

eDNA detections136

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 77 variable positions, in barcode order

1Cmostly conserved

4Gmostly conserved

19Gvariable

25Gmostly conserved

28Amostly conserved

29Gmostly conserved

40Cmostly conserved

46Tmostly conserved

52Amostly conserved

64Amostly conserved

67Tmostly conserved

79Amostly conserved

82Tmostly conserved

85Cvariable

136Amostly conserved

140Amostly conserved

142Cmostly conserved

151Cmostly conserved

163Amostly conserved

175Tmostly conserved

187Tmostly conserved

199Amostly conserved

202Tmostly conserved

205Tmostly conserved

214Tmostly conserved

217Tmostly conserved

220Tmostly conserved

229Tmostly conserved

256Tmostly conserved

259Amostly conserved

268Amostly conserved

298Amostly conserved

299Amostly conserved

301Amostly conserved

302Gvariable

313Amostly conserved

316Amostly conserved

340Cmostly conserved

343Amostly conserved

349Amostly conserved

352Tmostly conserved

361Tmostly conserved

367Cmostly conserved

370Cmostly conserved

391Tmostly conserved

394Tmostly conserved

403Cmostly conserved

407Gmostly conserved

409Amostly conserved

415Cmostly conserved

424Cmostly conserved

430Amostly conserved

448Cmostly conserved

455Amostly conserved

469Cmostly conserved

475Tmostly conserved

487Tmostly conserved

505Tmostly conserved

511Tmostly conserved

520Cmostly conserved

523Amostly conserved

526Amostly conserved

529Tmostly conserved

538Cvariable

539Cmostly conserved

544Amostly conserved

550Gmostly conserved

553Tmostly conserved

554Tmostly conserved

565Tmostly conserved

575Cmostly conserved

580Amostly conserved

589Amostly conserved

619Tmostly conserved

634Tmostly conserved

640Cmostly conserved

643Cmostly conserved

CTTGTATTTTCTATTTGGGATTTGGGCAGGAATAATTGGCACCTCTATAAGACTTTTAATTCGAACTGAATTAGGAAGACCTGGCTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes26

BINs2

Most divergent pair12.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica chalybeasame genus8.9%Altica woodsisame genus9.0%Altica cornisame genus9.2%Altica tombacinasame genus9.8%Altica carduorumsame genus9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Altica oleracea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 959 records

Wild obs. + sensor2 685

Museum / vouchered1 265

Cultivated / captive2

Fossil7

Range

Area of Occupancy AOO9 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 723≤1 km 555≤10 km 600>10 km 21

1 899 georeferenced · 786 without coordinates

Open the mapobservation + sensor2 685

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 337≤1 km 464≤10 km 296>10 km 41

1 138 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence1 265

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	475
Tartu, EE	134
NTNU-VMlocation not on record	73
CBDClocation not on record	57
Natural History Museum Rotterdamlocation not on record	56
Olocation not on record	46
Helsinki, FI	38
Trondheim, NO	31
NHMOlocation not on record	30
Vitoria, ES	24
Salzburg, AT	24
Tilburg, NL	24
NSMKlocation not on record	18
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	16
Yamaguchi-shi, JP	12
Ugentlocation not on record	12
Chiba, JP	10
LSMlocation not on record	10
Bando, JP	10
Metsähallituslocation not on record	9
HUNMlocation not on record	8
Oulu, FI	8
NCMGlocation not on record	7
European Distributed Institute of Taxonomy (EDIT)location not on record	6
MZLUlocation not on record	5
BioFokuslocation not on record	4
Winterthur, CH	4
Sagamihara, JP	3
Philadelphia, US	3
neflocation not on record	3
South Kensington, GB	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
IFR-DNFlocation not on record	2
Tallinn, EE	1
Museo Entomologico de Leonlocation not on record	1
Tromsø, NO	1
NMOKlocation not on record	1
ZSMlocation not on record	1

39 institutions · 1 174 of 1 265 vouchered records shown · 91 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA136 detections

Where the DNA of Altica oleracea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found136

Studies independent surveys4

Countries13

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 136 detections have coordinates

Open the map13 countries0

Dry chalk grassandsRiparian forestShrubland14. Artificial - Terrestrial | 14.5 Urban Ar…UrbanHumid grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 5.10–20.0

Seasonal swing summer↔winter19.0 °C

Max temp (day)17.9 °C 9.60–25.4

Min temp (night)9.80 °C 0.9–15.2

Precipitation67.1 mm/mo 33.4–111

Air humidity59.5 % 53.9–62.3

Moisture balance-41.6 mm/mo -62.7–9.50

Vapour deficit648 Pa 352–1,024

Wind speed2.90 m/s 1.80–4.20

Cloud cover40.4 % 36.9–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Altica oleracea

At a glance

Sources7 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 959 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 959 records