Altica carduorum

(Guérin-Méneville, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records61

Data sources7

Biological traits0

DNA specimens6

eDNA detections1

Sources7 archives

Databases and archives Altica carduorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceTreeOfSex2n = 24

01Narrative

Altica carduorum is een keversoort uit de familie bladkevers (Chrysomelidae). De wetenschappelijke naam van de soort werd in 1858 gepubliceerd door Félix Édouard Guérin-Méneville.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica carduorum has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P631 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 96 variable positions, in barcode order

1Amostly conserved

2Gmostly conserved

3Cmostly conserved

4Amostly conserved

5Gmostly conserved

7Amostly conserved

16Cmostly conserved

25Gmostly conserved

28Avariable

29Tmostly conserved

31Amostly conserved

37Cmostly conserved

55Cmostly conserved

61Tmostly conserved

70Cmostly conserved

79Cmostly conserved

97Tmostly conserved

106Cmostly conserved

112Tmostly conserved

116Amostly conserved

127Cmostly conserved

133Amostly conserved

157Cmostly conserved

172Amostly conserved

175Amostly conserved

178Amostly conserved

196Tmostly conserved

232Tmostly conserved

235Amostly conserved

238Gmostly conserved

256Cmostly conserved

268Gmostly conserved

274Tmostly conserved

275Cmostly conserved

277Amostly conserved

289Tmostly conserved

292Amostly conserved

325Gmostly conserved

328Tmostly conserved

340Cmostly conserved

346Cmostly conserved

367Tmostly conserved

370Tmostly conserved

373Cmostly conserved

376Cmostly conserved

385Gmostly conserved

388Tmostly conserved

394Amostly conserved

406Amostly conserved

418Tmostly conserved

424Cmostly conserved

436Tmostly conserved

442Tmostly conserved

443Cmostly conserved

445Amostly conserved

447Amostly conserved

448Amostly conserved

451Tvariable

454Avariable

455Amostly conserved

457Tvariable

458Amostly conserved

460Amostly conserved

461Gmostly conserved

464Cmostly conserved

466Amostly conserved

469Amostly conserved

472Cvariable

473Tmostly conserved

475Amostly conserved

478Tmostly conserved

487Tmostly conserved

499Amostly conserved

502Amostly conserved

505Tmostly conserved

509Cmostly conserved

515Cmostly conserved

517Tmostly conserved

520Amostly conserved

529Tmostly conserved

544Cmostly conserved

554Tmostly conserved

556Amostly conserved

559Tmostly conserved

565Amostly conserved

577Cmostly conserved

580Cmostly conserved

589Gmostly conserved

592Amostly conserved

595Tmostly conserved

601Amostly conserved

604Amostly conserved

607Cmostly conserved

610Tmostly conserved

616Cmostly conserved

625Cmostly conserved

AGCAGGAATAATTGGCACCTCCATGAGATTATTAATCCGAACTGAATTAGGAAGCCCTGGTTCATTAATCGGAAATGACCAAATTTATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.3%

Haplotypes5

BINs3

Most divergent pair14.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica palustrissame genus4.8%Altica carinthiacasame genus5.9%Altica helianthemisame genus6.1%Altica tamaricissame genus6.7%Altica cornisame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Altica carduorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×TreeOfSex · invert

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

08Occurrence & distribution

Record type61 records

Wild obs. + sensor34

Museum / vouchered25

Fossil2

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 1≤1 km 6≤10 km 11

18 georeferenced · 16 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤1 km 11≤10 km 6>10 km 1

18 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	11
South Kensington, GB	4
UDlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Helsinki, FI	1
Tallinn, EE	1
Bavarian State Collection of Zoologylocation not on record	1

7 institutions · 23 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Altica carduorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 21.5–21.5

Seasonal swing summer↔winter21.5 °C

Max temp (day)25.5 °C

Min temp (night)14.7 °C

Precipitation83.7 mm/mo

Air humidity55.9 %

Moisture balance-36.2 mm/mo

Vapour deficit1,131 Pa

Wind speed0.8 m/s

Cloud cover39.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)