Altica helianthemi

(Allard, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records279

Data sources4

Biological traits2

DNA specimens5

eDNA detections0

Sources4 archives

Databases and archives Altica helianthemi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility279 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF279 records

DNA & barcodingBOLD5 specimens

01Narrative

Altica helianthemi is een keversoort uit de familie bladkevers (Chrysomelidae). De wetenschappelijke naam van de soort werd in 1859 gepubliceerd door Allard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica helianthemi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P537 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.66%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

12Cmostly conserved

99Cvariable

105Cmostly conserved

348Tvariable

498Avariable

534Gmostly conserved

ATTGTTACTGCCCATGCCTTTATTATAATTTTCTTCATAGTAATGCCAATAATAATTGGTGGCTTTGGAAACTGGCTTGTACCACTAATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica palustrissame genus5.4%Altica carduorumsame genus6.1%Altica tamaricissame genus6.7%Altica cornisame genus8.9%Altica fragariaesame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor236

Museum / vouchered42

Fossil1

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 104≤1 km 39≤10 km 42

185 georeferenced · 51 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 3≤1 km 8≤10 km 26

37 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	15
Salzburg, AT	9
Natural History Museum Rotterdamlocation not on record	5

3 institutions · 29 of 42 vouchered records shown · 13 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)