Altica palustris

(Weise, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records1 311

Data sources6

Biological traits2

DNA specimens40

eDNA detections27

Sources6 archives

Databases and archives Altica palustris's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 311 records

Environmental DNA1 datasets · 7 countries27 detections

DNA & barcodingBOLD40 specimens

01Narrative

Altica palustris is a species of flea beetle from a family of leaf beetles, that can be found in the Palearctic realm, including North Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica palustris has left across the world's sequence archives.

At a glance

DNA specimens40

BINs8

Marker genes2

eDNA detections27

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

50Gmostly conserved

59Gmostly conserved

62Cmostly conserved

80Cmostly conserved

86Tmostly conserved

137Cmostly conserved

141Gvariable

155Tmostly conserved

164Gmostly conserved

179Amostly conserved

191Cmostly conserved

194Gmostly conserved

197Tmostly conserved

215Avariable

233Tvariable

281Tmostly conserved

300Cmostly conserved

302Cvariable

328Gvariable

341Tmostly conserved

365Tvariable

410Gmostly conserved

413Tmostly conserved

419Cvariable

434Cvariable

449Cmostly conserved

455Amostly conserved

465Cmostly conserved

467Tmostly conserved

470Cmostly conserved

476Cvariable

480Tvariable

483Avariable

488Tvariable

497Cvariable

509Avariable

516Tmostly conserved

517Avariable

534Tmostly conserved

581Avariable

596Amostly conserved

605Cmostly conserved

614Gmostly conserved

623Tmostly conserved

629Gvariable

632Tvariable

635Cvariable

641Cmostly conserved

644Cvariable

CATTATACTTCCTATTTGGAATTTGAGCAGGAATAATTGGTACCTCCATGAGATTATTGATCCGAACTGAATTAGGAAGCCCTGGTTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes5

BINs8

Most divergent pair6.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica carduorumsame genus4.8%Altica carinthiacasame genus4.9%Altica helianthemisame genus5.4%Altica tamaricissame genus6.0%Altica cornisame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 311 records

Wild obs. + sensor909

Museum / vouchered400

Fossil2

Range

Area of Occupancy AOO3 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 332≤1 km 226≤10 km 243>10 km 2

803 georeferenced · 106 without coordinates

Open the mapobservation + sensor909

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 108≤1 km 156≤10 km 81>10 km 27

372 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence400

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	199
Helsinki, FI	37
NTNU-VMlocation not on record	23
NHMOlocation not on record	21
Olocation not on record	20
Oulu, FI	13
Trondheim, NO	9
Tartu, EE	8
South Kensington, GB	6
Tilburg, NL	6
Wellcome Sanger Institutelocation not on record	4
Metsähallituslocation not on record	4
TMPMlocation not on record	3
MZLUlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
BioFokuslocation not on record	2
ZSMlocation not on record	2
Tallinn, EE	2
neflocation not on record	2
Natural History Museum, Londonlocation not on record	2

20 institutions · 369 of 400 vouchered records shown · 31 without an institution code

09Environmental DNA27 detections

Where the DNA of Altica palustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 6.70–16.8

Seasonal swing summer↔winter15.7 °C

Max temp (day)13.9 °C 10.1–20.1

Min temp (night)7.60 °C 2.90–14.2

Precipitation50.6 mm/mo 35.3–77.0

Air humidity60.4 % 55.8–63.6

Moisture balance-57.5 mm/mo -66.3–6.80

Vapour deficit523 Pa 373–881

Wind speed4.30 m/s 2.50–5.10

Cloud cover45.0 % 38.3–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Altica palustris

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 311 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 311 records