Altica chalybea

Illiger, 1807 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records457

Data sources8

Biological traits0

DNA specimens11

eDNA detections0

Sources8 archives

Databases and archives Altica chalybea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility457 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF457 records

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Altica chalybea (grape flea beetle) is a leaf beetle which consumes the buds of grape vines, reducing vegetative growth.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica chalybea has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.70%

Haplotypes1

BIN1

Where individuals differ — all 11 variable positions, in barcode order

214Cmostly conserved

373Tmostly conserved

388Amostly conserved

400Tmostly conserved

403Tmostly conserved

442Tmostly conserved

484Tmostly conserved

589Cvariable

616Gvariable

622Tvariable

634Tvariable

AACATTATATTTTCTATTTGGAATTTGAGCAGGAATAATTGGTACCTCTATAAGACTTTTAATCCGAACTGAATTAGGAAGATCTGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica cornisame genus7.7%Altica oleraceasame genus8.9%Altica tombacinasame genus9.0%Altica carinthiacasame genus9.0%Altica palustrissame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Altica chalybea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type457 records

Wild obs. + sensor318

Museum / vouchered139

Range

Area of Occupancy AOO1 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 176≤1 km 44≤10 km 8>10 km 26

254 georeferenced · 64 without coordinates

Open the mapobservation + sensor318

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 6≤10 km 11>10 km 61

78 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	74
University of Central Floridalocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Biodiversity Institute of Ontariolocation not on record	4
College Station, US	2
Denver, US	2
WIlocation not on record	2
UDlocation not on record	2
Champaign, US	2
OSUClocation not on record	1
Lake Placid, US	1

11 institutions · 101 of 139 vouchered records shown · 38 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)