Altica kalmiae

(Melsheimer, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records97

Data sources6

Biological traits0

DNA specimens55

eDNA detections53

Sources6 archives

Databases and archives Altica kalmiae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility97 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF97 records

Environmental DNA1 datasets · 2 countries53 detections

DNA & barcodingBOLD55 specimens

01Narrative

Altica kalmiae is a species of flea beetle in the family Chrysomelidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica kalmiae has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes1

eDNA detections53

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

199Amostly conserved

270Gmostly conserved

438Cmostly conserved

450Cmostly conserved

543Amostly conserved

576Gmostly conserved

600Tmostly conserved

630Avariable

ACTCTATACTTTTTATTAGGAATTTGAGCAGGTATAATTGGTACCTCAATAAGACTTCTAATTCGAACTGAATTAGGAAGGCCTGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes3

BIN1

Most divergent pair0.78%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica torquatasame genus9.3%Altica chalybeasame genus10.0%Altica woodsisame genus10.2%Altica tombacinasame genus10.3%Altica engstromisame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor18

Museum / vouchered79

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 14≤1 km 2>10 km 2

18 georeferenced

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 79 records without

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	37
CUlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
College Station, US	1
North Carolina State University Insect Museumlocation not on record	1

5 institutions · 43 of 79 vouchered records shown · 36 without an institution code

09Environmental DNA53 detections

Where the DNA of Altica kalmiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map2 countries0

Foresttemperate woodland biome1. Forest & WoodlandMixed habitatWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 9.30–15.8

Seasonal swing summer↔winter24.1 °C

Max temp (day)20.0 °C 13.6–20.8

Min temp (night)11.7 °C 5.00–12.4

Precipitation115 mm/mo 93.2–141

Air humidity61.9 % 59.1–62.7

Moisture balance-10.9 mm/mo -19.6–33.2

Vapour deficit660 Pa 486–680

Wind speed2.50 m/s 2.40–3.10

Cloud cover47.5 % 44.6–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)