Alopecosa trabalis

(Clerck, 1757) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records3 730

Data sources8

Biological traits21

DNA specimens23

eDNA detections11

Sources8 archives

Databases and archives Alopecosa trabalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University21 traits · 30 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements30 literature sources21 traits

Occurrence & distributionGBIF3 730 records

Environmental DNA3 datasets · 3 countries11 detections

DNA & barcodingBOLD23 specimens

01Narrative

Alopecosa accentuata is a species of wolf spider found commonly in open habitats throughout continental Europe with a reported palearctic distribution. The female has a body length (excluding legs) of up to 12 mm, the male is rather smaller at up to 9 mm. The name was at one time treated as a nomen dubium, but is now considered the correct name of Alopecosa barbipes.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 30 sources

Pekár 2014aSchirmel et al. 2012Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Henriksen & Hilmo 2015Staręga et al. 2001SLU 2020Gajdoš et al. 2014Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Finch 2004Blick et al. 2016Kielhorn 2017Vangsgård et al. 1996Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Komposch & Steinberger 1999Blick & Scheidler 2004Nährig et al. 2003Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a

Morphometry6

Body length♀10·♂7.12 mm

Cephalothorax height2.11 mm

Cephalothorax length3.75 mm

Cephalothorax width2.59 mm

Fang length0.6 mm

Tibia I length1.42 mm

Predation4

Hunting guildground hunters

Prey diversity3 mm

Simple hunting guild IIwanderer

Web buildingno

Ecology9

Ballooningvery common

Circadian activity0.5 mm

Light0.75 mm

Light 2partly shaded

Moisture 10.25 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (2)

Stratum0 mm

Defence2

Primary defenceCrypsis

Retreatground

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa trabalis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs3

Marker genes1

eDNA detections11

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 58 variable positions, in barcode order

7Amostly conserved

13Amostly conserved

14Avariable

19Amostly conserved

23Avariable

28Avariable

31Gmostly conserved

43Avariable

58Avariable

61Gmostly conserved

70Gvariable

97Gmostly conserved

148Gvariable

184Gmostly conserved

190Tvariable

199Amostly conserved

211Amostly conserved

217Avariable

220Tmostly conserved

232Avariable

241Tvariable

262Avariable

265Amostly conserved

286Gvariable

289Avariable

304Amostly conserved

310Amostly conserved

313Amostly conserved

316Gmostly conserved

319Amostly conserved

322Amostly conserved

349Gvariable

352Gmostly conserved

355Gvariable

370Avariable

382Gvariable

391Tmostly conserved

421Tmostly conserved

430Amostly conserved

433Avariable

466Amostly conserved

469Amostly conserved

475Gmostly conserved

478Tvariable

481Avariable

493Avariable

526Amostly conserved

529Avariable

535Amostly conserved

550Amostly conserved

562Amostly conserved

577Amostly conserved

583Amostly conserved

592Amostly conserved

619Avariable

622Amostly conserved

625Tmostly conserved

631Gvariable

AACTTTATATTTAATATTAGGTATTTGATCGGCTATAATAGGAACTGCTATATCAGTATTGATTCGAATGGAATTAGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes4

BINs3

Most divergent pair5.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa taeniatasame genus3.2%Alopecosa pinetorumsame genus3.3%Alopecosa aculeatasame genus3.5%Alopecosa albofasciatasame genus5.0%Alopecosa pentherisame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 730 records

Wild obs. + sensor2 812

Museum / vouchered866

Cultivated / captive1

Other51

Origin

Native949

Range

Area of Occupancy AOO2 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 127≤1 km 84≤10 km 2 284>10 km 6

2 501 georeferenced · 311 without coordinates

Open the mapobservation + sensor2 812

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 8≤1 km 51≤10 km 388>10 km 8

455 georeferenced · 411 without coordinates

Open the institutions mapphysical evidence866

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	279
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	247
Uniwersytet w Białymstokulocation not on record	50
Frankfurt am Main	22
Ekaterinburg, RU	22
EIBElocation not on record	21
Musee d'Histoire Naturallelocation not on record	20
Paro, BT	15
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	12
	11
Bonn, DE	7
Bern, CH	6
Helsinki, FI	5
Geneva, CH	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
SLU Artdatabankenlocation not on record	4
Prioksko-Terrasnyi Biosphere Reservelocation not on record	3
Washington, US	3
ZSMlocation not on record	2
Provincia di Livornolocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Akademia Pomorska w Słupskulocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Copenhagen, DK	2
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	2
Paris, FR	1
Universite de Montpellierlocation not on record	1
FETSlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

31 institutions · 757 of 866 vouchered records shown · 109 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Alopecosa trabalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys3

Countries3

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 3.20–17.2

Seasonal swing summer↔winter17.6 °C

Max temp (day)18.8 °C 6.70–21.8

Min temp (night)12.5 °C -0.8–15.6

Precipitation68.5 mm/mo 55.6–93.0

Air humidity60.1 % 57.7–63.4

Moisture balance-50.2 mm/mo -86.2–46.2

Vapour deficit740 Pa 284–809

Wind speed4.00 m/s 2.40–6.20

Cloud cover43.8 % 41.2–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecosa trabalis

At a glance

Sources8 archives

Morphometry6

Predation4

Ecology9

Defence2

At a glance

Record type3 730 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 730 records