Alopecosa taeniata

(C.L.Koch, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records2 923

Data sources8

Biological traits9

DNA specimens44

eDNA detections3

Sources8 archives

Databases and archives Alopecosa taeniata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 923 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

World Spider Trait DBMasaryk University9 traits · 15 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements15 literature sources9 traits

Occurrence & distributionGBIF2 923 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD44 specimens

01Narrative

Die Mittelgebirgs-Scheintarantel (Alopecosa taeniata) ist eine Spinne aus der Familie der Wolfsspinnen (Lycosidae). Die Art ist paläarktisch verbreitet und gebietsweise häufig vorfindbar.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 15 sources

Birkhofer et al. 2017Buchar & Růžička 2002Hyvärinen et al. 2019Henriksen & Hilmo 2015SLU 2020Gajdoš & Svatoň 2001Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Sacher & Platen 2004Liste France 2018Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀9.6·♂8.5 mm

Predation2

Hunting guildground hunters

Simple hunting guild classificationcursorial

Ecology6

Ballooninglow

Light 2partly shaded

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEcologically Sustainable (ES)

Stratumsurface

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa taeniata has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections3

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

16Amostly conserved

23Gmostly conserved

28Amostly conserved

40Amostly conserved

43Gvariable

61Gmostly conserved

70Amostly conserved

73Amostly conserved

121Tmostly conserved

217Gvariable

241Avariable

265Gvariable

286Avariable

304Gmostly conserved

307Tmostly conserved

316Amostly conserved

352Amostly conserved

355Amostly conserved

370Gmostly conserved

382Amostly conserved

415Gvariable

430Amostly conserved

433Amostly conserved

473Tmostly conserved

475Gvariable

484Tvariable

490Gmostly conserved

514Amostly conserved

529Tmostly conserved

556Gmostly conserved

AACTTTATATTTAATATTAGGTGTTTGATCGGCTATAATAGGGACTGCTATATCAGTATTGATTCGAATAGAATTAGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes17

BINs2

Most divergent pair4.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa pinetorumsame genus2.4%Alopecosa trabalissame genus3.2%Alopecosa pulverulentasame genus3.2%Alopecosa cuneatasame genus3.3%Alopecosa albofasciatasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 923 records

Wild obs. + sensor766

Museum / vouchered2 146

Cultivated / captive4

Other7

Origin

Native326

Range

Area of Occupancy AOO2 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 363≤1 km 127≤10 km 265>10 km 3

758 georeferenced · 8 without coordinates

Open the mapobservation + sensor766

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 381≤1 km 437≤10 km 604>10 km 169

1 591 georeferenced · 555 without coordinates

Open the institutions mapphysical evidence2 146

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	824
Bern, CH	404
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	333
Akademia Pomorska w Słupskulocation not on record	153
Provincia di Livornolocation not on record	58
Ekaterinburg, RU	52
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	32
NTNU-VMlocation not on record	16
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	15
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	10
Paro, BT	8
Metsähallituslocation not on record	7
SLU Artdatabankenlocation not on record	7
Rovaniemi, FI	5
Frankfurt am Main	5
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
Brussels, BE	4
Paris, FR	3
Bonn, DE	3
Washington, US	3
University of Oulu, Zoological Museumlocation not on record	2
neflocation not on record	2
Uniwersytet w Białymstokulocation not on record	1
	1

24 institutions · 1 952 of 2 146 vouchered records shown · 194 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Alopecosa taeniata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.80 °C 1.80–2.00

Seasonal swing summer↔winter26.9 °C

Max temp (day)4.30 °C 3.80–4.30

Min temp (night)-0.8 °C -0.8–0.2

Precipitation67.4 mm/mo 50.6–67.4

Air humidity66.9 % 65.2–66.9

Moisture balance25.5 mm/mo

Vapour deficit306 Pa 306–306

Wind speed2.80 m/s

Cloud cover57.1 % 53.1–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecosa taeniata

At a glance

Sources8 archives

Morphometry1

Predation2

Ecology6

At a glance

Record type2 923 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 923 records