Alopecosa pinetorum

(Thorell, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records527

Data sources7

Biological traits7

DNA specimens12

eDNA detections3

Sources7 archives

Databases and archives Alopecosa pinetorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility527 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University7 traits · 16 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements16 literature sources7 traits

Occurrence & distributionGBIF527 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD12 specimens

01Narrative

Alopecosa pinetorum is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Alopecosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1856 door Tord Tamerlan Teodor Thorell.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 16 sources

LGBl 2015Buchar & Růžička 2002Bruun & Lissner 2019Hyvärinen et al. 2019Henriksen & Hilmo 2015SLU 2020Gajdoš & Svatoň 2001Gajdoš et al. 2014Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Hiebsch & Tolke 1996Noflatscher 1994Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀12·♂10.5 mm

Predation1

Hunting guildground hunters

Ecology5

Legal protectionYes

Light 2partly shaded

Moisture 2humid

Regional IUCN Red List categoryData Deficient (DD)

Regional non-IUCN Red List categoryEndangered (EN)

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa pinetorum has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections3

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes1

BIN1

Where individuals differ — all 60 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

14Amostly conserved

15Tmostly conserved

16Amostly conserved

17Tmostly conserved

19Amostly conserved

20Gmostly conserved

22Tmostly conserved

23Gmostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Gmostly conserved

32Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

39Tmostly conserved

40Amostly conserved

42Gmostly conserved

43Gmostly conserved

45Cmostly conserved

46Tmostly conserved

47Gmostly conserved

49Tmostly conserved

50Amostly conserved

54Cmostly conserved

55Amostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

61Gmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

166Amostly conserved

AACTTTATATTTAATATTAGGTGTTTGATCGGCTATAATAGGGACTGCTATATCAGTATTGATTCGAATAGAATTAGGTAATCCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa aculeatasame genus2.3%Alopecosa taeniatasame genus2.4%Alopecosa trabalissame genus3.3%Alopecosa cuneatasame genus3.3%Alopecosa pulverulentasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type527 records

Wild obs. + sensor240

Museum / vouchered286

Other1

Origin

Native1

Range

Area of Occupancy AOO1 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 141≤1 km 65≤10 km 19>10 km 2

227 georeferenced · 13 without coordinates

Open the mapobservation + sensor240

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 39≤1 km 102≤10 km 54>10 km 22

217 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence286

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	139
Ekaterinburg, RU	45
Akademia Pomorska w Słupskulocation not on record	31
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	14
SLU Artdatabankenlocation not on record	14
Tartu, EE	12
Rovaniemi, FI	8
MZLUlocation not on record	4
Copenhagen, DK	4
University of Oulu, Zoological Museumlocation not on record	2
Uniwersytet w Białymstokulocation not on record	1
NTNU-VMlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

15 institutions · 278 of 286 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Alopecosa pinetorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.80 °C 1.80–1.80

Seasonal swing summer↔winter26.9 °C

Max temp (day)4.30 °C

Min temp (night)-0.8 °C

Precipitation67.4 mm/mo

Air humidity66.9 %

Moisture balance25.5 mm/mo

Vapour deficit306 Pa

Wind speed2.80 m/s

Cloud cover57.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)