Alopecosa albofasciata

(Brullé, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records5 984

Data sources8

Biological traits9

DNA specimens120

eDNA detections119

Sources8 archives

Databases and archives Alopecosa albofasciata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 984 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI119 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics120 specimens↗

World Spider Trait DBMasaryk University9 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF5 984 records

Environmental DNA1 datasets · 5 countries119 detections

DNA & barcodingBOLD120 specimens

01Narrative

Alopecosa albofasciata est une espèce d'araignées aranéomorphes de la famille des Lycosidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMacías-Hernández et al. 2020Gajdoš et al. 2014

Morphometry6

Body length♀8.3·♂7.5 mm

Cephalothorax height♀2.5·♂2.25 mm

Cephalothorax length♀3.9·♂4.8 mm

Cephalothorax width♀2.88·♂3.4 mm

Fang length♀0.94·♂0.93 mm

Tibia I length♀1.98·♂2.28 mm

Ecology3

Circadian activity0 mm

Regional IUCN Red List categoryLeast Concern (LC)

Stratum0.02 mm

05DNA & barcoding120 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa albofasciata has left across the world's sequence archives.

At a glance

DNA specimens120

BINs4

Marker genes1

eDNA detections119

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

19Avariable

124Amostly conserved

166Gmostly conserved

199Gmostly conserved

232Gmostly conserved

244Avariable

265Gmostly conserved

356Amostly conserved

382Amostly conserved

418Tmostly conserved

430Amostly conserved

439Tmostly conserved

469Amostly conserved

535Gmostly conserved

562Gmostly conserved

580Avariable

631Amostly conserved

AACTTTATATTTAATATTAGGTGTTTGATCGGCAATAATAGGAACTGCTATATCAGTATTAATTCGAATAGAATTAGGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes40

BINs4

Most divergent pair2.7%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa pulverulentasame genus4.4%Alopecosa aculeatasame genus4.6%Alopecosa cuneatasame genus4.6%Alopecosa taeniatasame genus4.9%Alopecosa trabalissame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 984 records

Wild obs. + sensor5 326

Museum / vouchered616

Other42

Origin

Native127

Range

Area of Occupancy AOO10 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 1 133≤1 km 429≤10 km 2 387>10 km 136

4 085 georeferenced · 1 241 without coordinates

Open the mapobservation + sensor5 326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 5≤1 km 2≤10 km 307>10 km 9

323 georeferenced · 293 without coordinates

Open the institutions mapphysical evidence616

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	45
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	15
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	6
CIBIOlocation not on record	5
FETSlocation not on record	4
Cambridge, US	3
University of Tokyo, Department of Zoologylocation not on record	2
Bonn, DE	2
Royal Museum for Central Africalocation not on record	1
Barcelona, ES	1
Ekaterinburg, RU	1
Beijing Natural History Museumlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
South Kensington, GB	1

15 institutions · 89 of 616 vouchered records shown · 527 without an institution code

09Environmental DNA119 detections

Where the DNA of Alopecosa albofasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found119

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 119 detections have coordinates

Open the map5 countries0

Dry acidic grasslandsNon-coniferous evergreen forestRiparian forestRivuline vegetationPiege lumineuxMediterranean forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 5.60–17.5

Seasonal swing summer↔winter20.6 °C

Max temp (day)17.2 °C 8.90–21.4

Min temp (night)6.20 °C 0.6–11.8

Precipitation70.0 mm/mo 40.1–101

Air humidity56.9 % 51.5–62.5

Moisture balance-31.3 mm/mo -86.7–35.7

Vapour deficit619 Pa 346–871

Wind speed2.80 m/s 1.80–4.40

Cloud cover42.6 % 28.6–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 119 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecosa albofasciata

At a glance

Sources8 archives

Morphometry6

Ecology3

At a glance

Record type5 984 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 984 records