Allantus togatus

(Panzer, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records249

Data sources6

Biological traits0

DNA specimens24

eDNA detections27

Sources6 archives

Databases and archives Allantus togatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility249 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF249 records

Environmental DNA4 datasets · 8 countries27 detections

DNA & barcodingBOLD24 specimens

01Narrative

Allantus togatus is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1801 door Panzer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus togatus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections27

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

2Tmostly conserved

3Amostly conserved

5Amostly conserved

7Tmostly conserved

10Amostly conserved

13Tmostly conserved

14Tmostly conserved

15Tmostly conserved

16Gmostly conserved

17Gmostly conserved

18Amostly conserved

20Tmostly conserved

21Tmostly conserved

23Gmostly conserved

24Amostly conserved

25Tmostly conserved

26Cmostly conserved

27Gvariable

28Gmostly conserved

29Gmostly conserved

30Tmostly conserved

31Amostly conserved

33Gvariable

34Tmostly conserved

35Tmostly conserved

37Gmostly conserved

54Amostly conserved

73Gmostly conserved

99Cmostly conserved

102Cmostly conserved

106Cmostly conserved

114Tmostly conserved

150Tmostly conserved

156Amostly conserved

165Cmostly conserved

168Cmostly conserved

177Gvariable

183Tmostly conserved

192Amostly conserved

196Amostly conserved

202Cmostly conserved

213Tmostly conserved

270Amostly conserved

279Tmostly conserved

282Tmostly conserved

283Tmostly conserved

330Tmostly conserved

333Tmostly conserved

336Cmostly conserved

339Avariable

342Tvariable

366Amostly conserved

375Amostly conserved

393Tmostly conserved

408Cmostly conserved

414Cmostly conserved

424Cmostly conserved

429Amostly conserved

432Gmostly conserved

456Cmostly conserved

466Amostly conserved

467Cmostly conserved

495Cmostly conserved

516Tmostly conserved

525Cmostly conserved

537Tmostly conserved

574Cmostly conserved

576Amostly conserved

579Cmostly conserved

612Cmostly conserved

621Gvariable

624Gmostly conserved

627Amostly conserved

630Cmostly conserved

642Cmostly conserved

TTATATTTTATTTTTGGATTTTGATCGGGTATGTTAGGATTATCATTTAGAATATTAATTCGAATAGAATTAGGAATACCAGGATCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes10

BINs2

Most divergent pair6.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachyprotasis antennatasame family12.4%Pachyprotasis rapaesame family12.6%Ametastegia tenerasame family12.7%Ametastegia apertasame family12.9%Ametastegia recenssame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057612 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type249 records

Wild obs. + sensor168

Museum / vouchered81

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 63≤1 km 33≤10 km 58>10 km 1

155 georeferenced · 13 without coordinates

Open the mapobservation + sensor168

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 7≤1 km 10≤10 km 26

43 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	12
ZSMlocation not on record	6
NHMOlocation not on record	3
Helsinki, FI	2
BioFokuslocation not on record	2
SLU Artdatabankenlocation not on record	2
Bonn, DE	2
Tilburg, NL	2
Zürich, CH	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

11 institutions · 34 of 81 vouchered records shown · 45 without an institution code

09Environmental DNA27 detections

Where the DNA of Allantus togatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys4

Countries8

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map8 countries0

Nedlagt, ganske sterkt gjengrodd sandtak med…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 13.3–18.5

Seasonal swing summer↔winter23.5 °C

Max temp (day)18.8 °C 16.2–22.5

Min temp (night)11.0 °C 9.90–14.1

Precipitation71.1 mm/mo 53.2–87.4

Air humidity58.0 % 55.9–63.6

Moisture balance-39.2 mm/mo -58.1–14.7

Vapour deficit704 Pa 562–904

Wind speed2.60 m/s 2.10–4.50

Cloud cover46.3 % 35.2–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)