Pachyprotasis antennata

(Klug, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Pachyprotasis

At a glance

Occurrence records531

Data sources7

Biological traits0

DNA specimens35

eDNA detections38

Sources7 archives

Databases and archives Pachyprotasis antennata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF531 records

Environmental DNA3 datasets · 11 countries38 detections

DNA & barcodingBOLD35 specimens

01Narrative

Pachyprotasis antennata is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachyprotasis antennata has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections38

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

4Gmostly conserved

23Tmostly conserved

31Tmostly conserved

38Cmostly conserved

67Gmostly conserved

85Cmostly conserved

88Amostly conserved

121Tmostly conserved

181Cmostly conserved

214Amostly conserved

274Tmostly conserved

290Cmostly conserved

295Amostly conserved

322Amostly conserved

325Tmostly conserved

334Tmostly conserved

343Tmostly conserved

346Cmostly conserved

373Gmostly conserved

415Amostly conserved

421Cmostly conserved

451Tmostly conserved

463Tmostly conserved

469Tmostly conserved

493Tmostly conserved

520Tmostly conserved

530Cmostly conserved

532Tmostly conserved

547Tmostly conserved

565Amostly conserved

568Amostly conserved

586Tmostly conserved

619Tmostly conserved

622Gmostly conserved

625Tmostly conserved

631Amostly conserved

637Tmostly conserved

641Cmostly conserved

642Tmostly conserved

643Tmostly conserved

646Tmostly conserved

653Tmostly conserved

AACGTTATATTTTATTTTTGGATTTTGATCTGGAATACTAGGATTATCATTTAGAATATTAATTCGGACAGAATTAGGAATACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair5.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachyprotasis simulanssame genus4.6%Pachyprotasis variegatasame genus5.0%Pachyprotasis rapaesame genus5.3%Pachyprotasis formosanasame genus5.9%Macrophya rufipessame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type531 records

Wild obs. + sensor283

Museum / vouchered248

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 115≤1 km 67≤10 km 34>10 km 8

224 georeferenced · 59 without coordinates

Open the mapobservation + sensor283

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 111≤1 km 25≤10 km 38>10 km 1

175 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	90
BioFokuslocation not on record	17
Oulu, FI	16
Provincia di Livornolocation not on record	13
Stockholm, SE	8
ZSMlocation not on record	7
Bavarian State Collection of Zoologylocation not on record	5
SLU Artdatabankenlocation not on record	4
Philadelphia, US	3
University of Oslo, Natural History Museumlocation not on record	2
University of Oululocation not on record	2
MZLUlocation not on record	2
neflocation not on record	2
NEFlocation not on record	1
NTNU-VMlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
Champaign, US	1

19 institutions · 177 of 248 vouchered records shown · 71 without an institution code

09Environmental DNA38 detections

Where the DNA of Pachyprotasis antennata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys3

Countries11

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 9.70–17.3

Seasonal swing summer↔winter22.3 °C

Max temp (day)18.6 °C 14.2–21.1

Min temp (night)10.7 °C 3.90–13.6

Precipitation78.2 mm/mo 71.1–149

Air humidity58.7 % 57.3–63.7

Moisture balance-37.6 mm/mo -51.0–33.6

Vapour deficit704 Pa 419–796

Wind speed2.80 m/s 1.90–4.30

Cloud cover46.7 % 36.0–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)