Pachyprotasis rapae

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Pachyprotasis

At a glance

Occurrence records4 855

Data sources9

Biological traits0

DNA specimens217

eDNA detections310

Sources9 archives

Databases and archives Pachyprotasis rapae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 855 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI310 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics217 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 855 records

Environmental DNA4 datasets · 15 countries310 detections

DNA & barcodingBOLD217 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Pachyprotasis rapae is a species of common sawfly in the family Tenthredinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding217 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachyprotasis rapae has left across the world's sequence archives.

At a glance

DNA specimens217

BINs6

Marker genes1

eDNA detections310

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus127 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

30Tmostly conserved

37Cmostly conserved

57Gvariable

68Tvariable

72Gvariable

73Cmostly conserved

76Gmostly conserved

78Tmostly conserved

84Tmostly conserved

90Tmostly conserved

99Tmostly conserved

117Cmostly conserved

132Cvariable

162Tvariable

168Amostly conserved

180Avariable

183Avariable

195Amostly conserved

205Tvariable

213Amostly conserved

270Amostly conserved

303Avariable

309Tmostly conserved

321Avariable

327Avariable

333Tmostly conserved

339Cvariable

345Tvariable

360Avariable

384Tvariable

423Avariable

432Avariable

450Tvariable

535Cvariable

537Amostly conserved

540Tmostly conserved

541Tmostly conserved

555Avariable

600Tmostly conserved

618Cmostly conserved

627Gvariable

ACATTATATTTTATTTTTGGATTTTGATCTGGAATACTAGGATTATCATTTAGAATGTTAATTCGAATAGAGCTAGGTATACCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes13

BINs6

Most divergent pair4.7%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachyprotasis variegatasame genus4.0%Pachyprotasis antennatasame genus5.3%Pachyprotasis simulanssame genus5.7%Pachyprotasis formosanasame genus6.4%Macrophya rufipessame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Pachyprotasis rapae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records10–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 101×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type4 855 records

Wild obs. + sensor2 956

Museum / vouchered1 899

Range

Area of Occupancy AOO9 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 808≤1 km 377≤10 km 1 369>10 km 23

2 577 georeferenced · 379 without coordinates

Open the mapobservation + sensor2 956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 802≤1 km 259≤10 km 262>10 km 5

1 328 georeferenced · 571 without coordinates

Open the institutions mapphysical evidence1 899

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	504
BioFokuslocation not on record	167
Provincia di Livornolocation not on record	166
ZMAAlocation not on record	66
Oulu, FI	66
NCMGlocation not on record	51
Tilburg, NL	45
University of Guelph, Centre for Biodiversity Genomicslocation not on record	26
OSUClocation not on record	26
ZSMlocation not on record	23
SLU Artdatabankenlocation not on record	23
Tromsø, NO	23
Stockholm, SE	22
neflocation not on record	21
NTNU-VMlocation not on record	17
Philadelphia, US	9
Bavarian State Collection of Zoologylocation not on record	9
University of Central Floridalocation not on record	8
Edmonton, CA	8
Natural History Museum Rotterdamlocation not on record	8
Champaign, US	7
Gothenburg, SE	5
Muzeum Górnośląskie w Bytomiulocation not on record	5
Institute of Zoology Slovak Academy of Scienceslocation not on record	4
Toronto, CA	4
Nijmegen, NL	4
University of Oululocation not on record	4
Ugentlocation not on record	4
DFFW2018location not on record	4
Helsinki, FI	3
MZLUlocation not on record	3
Washington State Department of Agriculturelocation not on record	2
South Kensington, GB	2
University of Oslo, Natural History Museumlocation not on record	2
DFlocation not on record	2
MNHWlocation not on record	1
Private Collection of H. Haraldseidelocation not on record	1
Tartu, EE	1
Wellcome Sanger Institutelocation not on record	1
Vancouver, CA	1
Natural History Museum, Londonlocation not on record	1
University of Alaska Museumlocation not on record	1
Oberoesterreichisches Landesmuseum, Biologiezentrum, Linzlocation not on record	1

43 institutions · 1 351 of 1 899 vouchered records shown · 548 without an institution code

09Environmental DNA310 detections

Where the DNA of Pachyprotasis rapae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found310

Studies independent surveys4

Countries15

Verifiable raw sequence linked117

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 310 detections have coordinates

Open the map15 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…1. Forest & Woodland|1.1. Boreal Forest4. Native Grassland|4.2 Subarctic Grassland1. Forest & Woodland | 1.4. Temperate ForestForestFarmenvironment, farmland, coast and birch h…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 7.80–15.8

Seasonal swing summer↔winter21.6 °C

Max temp (day)16.5 °C 11.7–19.5

Min temp (night)8.20 °C 2.90–10.9

Precipitation76.3 mm/mo 54.4–123

Air humidity58.4 % 55.1–62.1

Moisture balance-27.1 mm/mo -53.5–43.3

Vapour deficit634 Pa 424–720

Wind speed2.80 m/s 2.20–4.70

Cloud cover47.3 % 36.8–59.0

CHELSA 1981–2010, ~9 km grid, at location & month of 308 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pachyprotasis rapae

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 855 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 855 records