Allantus rufocinctus

(Retzius, 1783) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records464

Data sources7

Biological traits0

DNA specimens42

eDNA detections0

Sources7 archives

Databases and archives Allantus rufocinctus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility464 records↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF464 records

DNA & barcodingBOLD42 specimens

Genome at a glanceGoaT · NCBI≈273 Mbp

01Narrative

Allantus rufocinctus is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1783 door Retzius.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus rufocinctus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs3

Marker genes1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 91 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Cmostly conserved

54Gmostly conserved

56Amostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

78Gmostly conserved

80Amostly conserved

81Tmostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Gmostly conserved

99Gmostly conserved

100Gmostly conserved

101Amostly conserved

118Cmostly conserved

187Tmostly conserved

208Amostly conserved

256Amostly conserved

265Amostly conserved

274Amostly conserved

280Cmostly conserved

294Tmostly conserved

340Tmostly conserved

346Tmostly conserved

364Cmostly conserved

382Cmostly conserved

424Gmostly conserved

445Tmostly conserved

483Cmostly conserved

505Cmostly conserved

514Amostly conserved

536Cmostly conserved

598Tmostly conserved

628Gmostly conserved

634Tmostly conserved

AACTTTATATTTTATTTTTGGATTTTGATCTGGAATATTAGGATTATCATTCAGAATACTAATTCGTATAGAATTAAGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes8

BINs3

Most divergent pair4.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allantus albolabrissame genus2.0%Allantus calceatussame genus2.3%Allantus cinctussame genus3.3%Allantus truncatussame genus3.3%Allantus basalissame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Allantus rufocinctus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈272 621 412 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Allantus rufocinctus0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type464 records

Wild obs. + sensor194

Museum / vouchered270

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 114≤1 km 23≤10 km 30

167 georeferenced · 27 without coordinates

Open the mapobservation + sensor194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 89≤1 km 29≤10 km 46>10 km 4

168 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	89
BioFokuslocation not on record	31
Oulu, FI	25
Stockholm, SE	12
SLU Artdatabankenlocation not on record	12
Institute of Zoology Slovak Academy of Scienceslocation not on record	10
Zürich, CH	8
ZSMlocation not on record	7
MZLUlocation not on record	5
neflocation not on record	4
NEFlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
South Kensington, GB	2
DFlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Tromsø, NO	1
NCMGlocation not on record	1

17 institutions · 214 of 270 vouchered records shown · 56 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)