Allantus calceatus

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records615

Data sources7

Biological traits0

DNA specimens52

eDNA detections20

Sources7 archives

Databases and archives Allantus calceatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF615 records

Environmental DNA3 datasets · 6 countries20 detections

DNA & barcodingBOLD52 specimens

Genome at a glanceGoaT2n = 16

01Narrative

Allantus calceatus is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus calceatus has left across the world's sequence archives.

At a glance

DNA specimens52

BINs4

Marker genes1

eDNA detections20

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Cvariable

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Cmostly conserved

54Gmostly conserved

56Amostly conserved

59Cmostly conserved

61Avariable

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

78Gmostly conserved

80Amostly conserved

81Tmostly conserved

83Cmostly conserved

84Cmostly conserved

85Avariable

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Gmostly conserved

99Gmostly conserved

100Avariable

101Amostly conserved

127Tvariable

142Tvariable

187Tmostly conserved

208Avariable

217Amostly conserved

256Tvariable

259Tvariable

274Avariable

284Tmostly conserved

287Cmostly conserved

289Cvariable

290Tmostly conserved

322Tmostly conserved

337Avariable

340Tvariable

343Tvariable

346Tvariable

361Tvariable

364Cvariable

382Tvariable

421Amostly conserved

433Avariable

448Tvariable

467Cmostly conserved

468Gmostly conserved

484Amostly conserved

514Avariable

596Tmostly conserved

625Avariable

634Cvariable

641Tmostly conserved

AACCTTATATTTTATTTTTGGATTTTGATCTGGAATATTAGGATTATCATTCAGAATACTAATTCGTATAGAATTAAGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes11

BINs4

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allantus rufocinctussame genus2.3%Allantus albolabrissame genus2.3%Allantus basalissame genus2.4%Allantus nigritibialissame genus3.8%Allantus mellipessame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Allantus calceatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type615 records

Wild obs. + sensor316

Museum / vouchered299

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 142≤1 km 43≤10 km 101>10 km 3

289 georeferenced · 27 without coordinates

Open the mapobservation + sensor316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 55≤1 km 31≤10 km 85>10 km 3

174 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence299

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	59
BioFokuslocation not on record	42
ZMAAlocation not on record	36
Oulu, FI	23
Zürich, CH	17
Tilburg, NL	14
ZSMlocation not on record	13
neflocation not on record	10
Philadelphia, US	7
Bavarian State Collection of Zoologylocation not on record	6
Tromsø, NO	4
NEFlocation not on record	3
MZLUlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	2
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Helsinki, FI	1
NCMGlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
SLU Artdatabankenlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

21 institutions · 246 of 299 vouchered records shown · 53 without an institution code

09Environmental DNA20 detections

Where the DNA of Allantus calceatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys3

Countries6

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map6 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 9.30–17.0

Seasonal swing summer↔winter18.6 °C

Max temp (day)17.8 °C 12.3–20.9

Min temp (night)10.2 °C 7.10–13.0

Precipitation78.2 mm/mo 39.6–103

Air humidity58.8 % 57.4–60.8

Moisture balance-38.6 mm/mo -86.2–-20.7

Vapour deficit670 Pa 502–765

Wind speed3.60 m/s 2.70–5.30

Cloud cover39.8 % 33.5–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)