Allantus basalis

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records391

Data sources6

Biological traits0

DNA specimens53

eDNA detections77

Sources6 archives

Databases and archives Allantus basalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility391 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF391 records

Environmental DNA3 datasets · 7 countries77 detections

DNA & barcodingBOLD53 specimens

01Narrative

Allantus basalis is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus basalis has left across the world's sequence archives.

At a glance

DNA specimens53

BINs8

Marker genes1

eDNA detections77

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

4Tmostly conserved

10Cvariable

43Avariable

52Cmostly conserved

64Tmostly conserved

80Avariable

91Amostly conserved

100Avariable

106Tvariable

110Amostly conserved

118Tmostly conserved

127Tmostly conserved

130Cvariable

133Cvariable

142Tmostly conserved

202Tmostly conserved

205Tvariable

206Cmostly conserved

220Amostly conserved

244Tmostly conserved

256Tvariable

259Tmostly conserved

265Tvariable

271Amostly conserved

274Amostly conserved

277Amostly conserved

280Tvariable

283Avariable

287Cmostly conserved

289Avariable

292Amostly conserved

294Cmostly conserved

310Tvariable

316Tvariable

322Tvariable

335Gvariable

337Tvariable

340Tmostly conserved

343Cvariable

347Cvariable

361Tmostly conserved

364Cvariable

382Tvariable

394Tmostly conserved

400Avariable

403Tmostly conserved

418Tvariable

424Amostly conserved

433Amostly conserved

451Tmostly conserved

464Tmostly conserved

483Gvariable

492Gvariable

505Cmostly conserved

514Amostly conserved

536Tvariable

542Tmostly conserved

556Tvariable

562Amostly conserved

598Avariable

619Amostly conserved

622Avariable

625Amostly conserved

628Tvariable

AACTTTATACTTTATTTTTGGATTTTGATCTGGAATATTAGGATTATCATTCAGAATACTAATTCGTATAGAATTAAGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes11

BINs8

Most divergent pair6.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allantus calceatussame genus2.4%Allantus nigritibialissame genus3.0%Allantus cinctussame genus3.2%Allantus rufocinctussame genus3.5%Allantus truncatussame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type391 records

Wild obs. + sensor51

Museum / vouchered340

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 25≤1 km 14≤10 km 4

43 georeferenced · 8 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 131≤1 km 21≤10 km 69>10 km 4

225 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence340

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	137
BioFokuslocation not on record	36
Oulu, FI	33
Stockholm, SE	9
SLU Artdatabankenlocation not on record	7
ZSMlocation not on record	5
NEFlocation not on record	4
NTNU-VMlocation not on record	3
neflocation not on record	3
Zürich, CH	1
Tromsø, NO	1
Bavarian State Collection of Zoologylocation not on record	1

12 institutions · 240 of 340 vouchered records shown · 100 without an institution code

09Environmental DNA77 detections

Where the DNA of Allantus basalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys3

Countries7

Verifiable raw sequence linked45

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map7 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 11.6–16.2

Seasonal swing summer↔winter24.1 °C

Max temp (day)16.7 °C 14.5–19.3

Min temp (night)8.50 °C 7.30–12.2

Precipitation75.1 mm/mo 53.7–101

Air humidity57.3 % 55.6–61.8

Moisture balance-29.2 mm/mo -60.2–14.1

Vapour deficit675 Pa 577–746

Wind speed2.70 m/s 1.90–3.30

Cloud cover51.1 % 39.6–59.1

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)