Allantus cinctus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records2 363

Data sources8

Biological traits0

DNA specimens97

eDNA detections57

Sources8 archives

Databases and archives Allantus cinctus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 363 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 363 records

Environmental DNA3 datasets · 6 countries57 detections

DNA & barcodingBOLD97 specimens

Genome at a glanceGoaT2n = 8

01Narrative

Allantus cinctus, known generally as the curled rose sawfly or banded rose sawfly, is a species of common sawfly in the family Tenthredinidae. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus cinctus has left across the world's sequence archives.

At a glance

DNA specimens97

BINs6

Marker genes1

eDNA detections57

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 58 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Cvariable

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

45Tmostly conserved

52Cmostly conserved

59Cmostly conserved

61Tvariable

67Tmostly conserved

69Tmostly conserved

72Amostly conserved

80Amostly conserved

85Avariable

88Avariable

92Tmostly conserved

97Tvariable

100Amostly conserved

101Amostly conserved

102Avariable

111Tvariable

184Amostly conserved

187Tvariable

208Tvariable

232Tmostly conserved

256Tvariable

263Cvariable

265Cvariable

274Tvariable

287Cmostly conserved

289Avariable

292Amostly conserved

334Amostly conserved

337Tvariable

340Cvariable

343Tvariable

346Cvariable

347Tmostly conserved

361Tvariable

364Tvariable

382Tvariable

390Cvariable

424Avariable

433Amostly conserved

448Tmostly conserved

459Tvariable

496Amostly conserved

514Tvariable

547Tvariable

616Cvariable

628Amostly conserved

634Cvariable

AACCTTATATTTTATTTTTGGATTTTGATCTGGAATATTAGGATTATCATTCAGAATACTTATTCGTATAGAATTAAGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes19

BINs6

Most divergent pair6.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allantus basalissame genus3.2%Allantus albolabrissame genus3.2%Allantus rufocinctussame genus3.3%Allantus nigritibialissame genus5.0%Allantus mellipessame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Allantus cinctus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 81×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 363 records

Wild obs. + sensor1 439

Museum / vouchered924

Range

Area of Occupancy AOO4 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 512≤1 km 261≤10 km 517>10 km 17

1 307 georeferenced · 132 without coordinates

Open the mapobservation + sensor1 439

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 415≤1 km 78≤10 km 152>10 km 4

649 georeferenced · 275 without coordinates

Open the institutions mapphysical evidence924

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	356
BioFokuslocation not on record	101
Champaign, US	59
Tilburg, NL	43
Oulu, FI	32
SLU Artdatabankenlocation not on record	29
ZMAAlocation not on record	28
Stockholm, SE	26
ZSMlocation not on record	24
Institute of Zoology Slovak Academy of Scienceslocation not on record	23
Helsinki, FI	23
Bavarian State Collection of Zoologylocation not on record	17
Zürich, CH	15
neflocation not on record	13
Vancouver, CA	7
MZLUlocation not on record	7
Tromsø, NO	5
OSUClocation not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
DFlocation not on record	4
Philadelphia, US	3
NCMGlocation not on record	3
Ugentlocation not on record	2
NEFlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
MNHWlocation not on record	1
WIlocation not on record	1
South Kensington, GB	1
Catholic University of Pekinglocation not on record	1

30 institutions · 839 of 924 vouchered records shown · 85 without an institution code

09Environmental DNA57 detections

Where the DNA of Allantus cinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys3

Countries6

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 7.70–17.4

Seasonal swing summer↔winter17.0 °C

Max temp (day)18.2 °C 9.70–21.6

Min temp (night)10.9 °C 4.30–14.0

Precipitation71.2 mm/mo 38.0–96.7

Air humidity60.2 % 57.5–63.5

Moisture balance-43.8 mm/mo -79.5–8.30

Vapour deficit647 Pa 424–787

Wind speed3.50 m/s 2.70–5.30

Cloud cover40.7 % 33.3–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allantus cinctus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 363 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 363 records