Alcyonium palmatum

Pallas, 1766 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Alcyonium

At a glance

Occurrence records931

Data sources9

Biological traits2

DNA specimens13

eDNA detections0

Sources9 archives

Databases and archives Alcyonium palmatum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility601 records↗

OBISOcean Biodiversity Information System330 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF · OBIS931 records

DNA & barcodingBOLD13 specimens

01Narrative

Alcyonium palmatum or red dead man's fingers is a species of soft coral in the family Alcyoniidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition10 compounds

Compounds documented for Alcyonium palmatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lanostane, Tirucallane and Euphane triterpenoids4

Dibenzocyclooctadienes lignans2

Acyclic monoterpenoids2

Sacculatane diterpenoids1

Arylnaphthalene and aryltetralin lignans $ Dibenzocyclooctadienes lignans1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(11S,12S,13S)-3,22-dimethoxy-12,13-dimethyl-5,7,18,20-tetraoxapentacyclo[13.7.0.02,10.04,8.017,21]docosa-1(22),2,4(8),9,15,17(21)-hexaen-11-ol	present	NPASS
(1S,2S,5E,9S,10S)-2,6,9-trimethyl-9-(4-methylpent-3-enyl)bicyclo[8.1.0]undec-5-en-2-ol	present	LOTUS
(5S,6S,7R)-4-methoxy-5-(7-methoxy-1,3-benzodioxol-5-yl)-6,7-dimethyl-5,6,7,8-tetrahydrobenzo[f][1,3]benzodioxole	present	NPASS
(Z,6R)-2-methyl-6-[(5R,10S,12R,14S)-4,4,10,12,14-pentamethyl-3-oxo-2,5,6,7,11,12,15,16-octahydro-1H-cyclopenta[a]phenanthren-17-yl]hept-2-enoic acid	present	NPASS
(Z,6R)-6-[(3S,5R,10S,13R,14R,17R)-3-hydroxy-4,4,10,13,14-pentamethyl-2,3,5,6,7,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]-2-methylhept-2-enoic acid	present	NPASS
(Z,6R)-6-[(5R,10S,12S,13R,14S,17R)-12-hydroxy-4,4,10,13,14-pentamethyl-3-oxo-1,2,5,6,7,11,12,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]-2-methylhept-2-enoic acid	present	NPASS
4-Methyl-2-(2-methyl-6-methylideneocta-2,7-dienyl)furan	present	LOTUS
4-methyl-2-[(2E)-2-methyl-6-methylideneocta-2,7-dienyl]furan	present	LOTUS
Anwuweizonic Acid	present	NPASS
Kadsurindutin H	present	NPASS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcyonium palmatum has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

4Gmostly conserved

7Tvariable

10Avariable

376Cmostly conserved

632Gmostly conserved

673Amostly conserved

676Cmostly conserved

682Ahighly variable

685Cvariable

688Tmostly conserved

692Gmostly conserved

693Tvariable

694Cvariable

TAAGGATATAGGTACTTTATATTTAATATTTGGTGCTTTTTCTGGGATGGCGGGGACAGCTTCGAGTATGTTAATACGGCTAGAACTGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes5

BIN1

Most divergent pair1.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcyonium variabilesame genus1.7%Alcyonium coralloidessame genus1.8%Alcyonium digitatumsame genus2.4%Alcyonium haddonisame genus2.6%Anthothela grandiflorasame family3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type931 records

Wild obs. + sensor195

Museum / vouchered405

Other331

Origin

Native1

Range

Area of Occupancy AOO1 864 km²

Depth

0–200 m sunlit235

200–1000 m twilight42

1–4 km midnight0

>4 km abyssal0

median 91.3 m · max 777 m · 277 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 22≤1 km 77≤10 km 10>10 km 4

113 georeferenced · 82 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 2≤10 km 4>10 km 2

8 georeferenced · 397 without coordinates

Open the institutions mapphysical evidence405

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	311
AUTHlocation not on record	18
Stockholm, SE	7
Washington, US	7
Turkmen Agricultural University named after S.A. Niyazovlocation not on record	7
Frankfurt am Main	6
IEO-COMA-CSIClocation not on record	4
Cambridge, US	3
Barcelona, ES	2
University of Oslo (UiO)location not on record	1
	1
Natural History Museum Rotterdamlocation not on record	1
South Kensington, GB	1
UB_ICMlocation not on record	1

14 institutions · 370 of 405 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)