Anthothela grandiflora

(Sars, 1856) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Anthothela

At a glance

Occurrence records1 397

Data sources7

Biological traits2

DNA specimens11

eDNA detections7

Sources7 archives

Databases and archives Anthothela grandiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility961 records↗

OBISOcean Biodiversity Information System436 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 397 records

Environmental DNA2 datasets · 1 countries7 detections

DNA & barcodingBOLD11 specimens

01Narrative

Clavularia bathybius is een zachte koraalsoort uit de familie Clavulariidae. De koraalsoort komt uit het geslacht Clavularia. Clavularia bathybius werd in 1870 voor het eerst wetenschappelijk beschreven door Saville Kent.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthothela grandiflora has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P786 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATGAACAAATATCTTACACGTTGGCTATTTTCTACTAATCATAAGGATATAGGTACTTTATATTTACTATTTGGTGCTTTTTCTGGGATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leptogorgia flexilissame order3.1%Ceratocaulon wandelisame order3.1%Leptogorgia albasame order3.2%Sclerophytum tumulosumsame order3.3%Sclerophytum peculiaresame order3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061997 ↗ · 14 protein · 1 tRNA · 2 rRNA

ND2ND5ND4COX3ATP6ATP8COX2COX1ND1CYTBND6ND3ND4LmutSrnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 397 records

Wild obs. + sensor1 100

Museum / vouchered288

Other9

Range

Area of Occupancy AOO748 km²

Depth

0–200 m sunlit55

200–1000 m twilight265

1–4 km midnight107

>4 km abyssal0

median 768.9 m · max 2 633 m · 427 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 952≤1 km 6≤10 km 4

962 georeferenced · 138 without coordinates

Open the mapobservation + sensor1 100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 23≤1 km 59≤10 km 10>10 km 2

94 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	44
Washington, US	29
New Haven, US	9
ICESlocation not on record	7
Cambridge, US	5
ARMS-MBONlocation not on record	5
South Kensington, GB	3
Gothenburg, SE	2
NTNU University Museum, Department of Natural Historylocation not on record	2
SLU Artdatabankenlocation not on record	2
EDMO:3685 (MMT Sweden AB)location not on record	1
EDMO:1979 (Fisheries and Oceans Canada - Marine Environmental Data Section (MEDS))location not on record	1
Museu Oceanografico do Vale do Itajailocation not on record	1
CASlocation not on record	1
Stockholm, SE	1
Goteborg Natural History Museumlocation not on record	1
NAFOlocation not on record	1

17 institutions · 115 of 288 vouchered records shown · 68 without an institution code

09Environmental DNA7 detections

Where the DNA of Anthothela grandiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries1

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 6.00–11.0

Seasonal swing summer↔winter17.1 °C

Max temp (day)13.1 °C 8.00–13.1

Min temp (night)8.50 °C 3.60–8.50

Precipitation51.5 mm/mo 47.0–51.5

Air humidity58.6 % 58.6–60.4

Moisture balance-63.7 mm/mo -63.7–-25.3

Vapour deficit544 Pa 370–544

Wind speed5.30 m/s 5.30–5.40

Cloud cover41.3 % 41.3–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthothela grandiflora

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 397 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 397 records