Alcyonium coralloides

(Pallas, 1766) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Alcyonium

At a glance

Occurrence records2 352

Data sources9

Biological traits2

DNA specimens8

eDNA detections0

Sources9 archives

Databases and archives Alcyonium coralloides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 263 records↗

OBISOcean Biodiversity Information System89 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS93 compounds

Occurrence & distributionGBIF · OBIS2 352 records

DNA & barcodingBOLD8 specimens

01Narrative

Alcyonium coralloides, commonly known as false coral, is a colonial species of soft coral in the family Alcyoniidae. It is native to the northeastern Atlantic Ocean and the Mediterranean Sea. In the former location it generally grows as sheets or small lobes but in the latter it is parasitic and overgrows sea fans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition93 compounds

Compounds documented for Alcyonium coralloides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pregnane steroids51

Eudesmane sesquiterpenoids6

Cembrane diterpenoids5

Dicarboxylic acids3

Germacrane sesquiterpenoids2

Documented compounds93 total

Tissue Source Quantified only

Compound	Amount	Source
(10E)-9-hydroxy-7,11-dimethyl-4-prop-1-en-2-yl-15,17-dioxatetracyclo[11.2.2.01,14.05,9]heptadeca-7,10-diene-6,16-dione	present	LOTUS
(1E,4S,5R,8S,13R,16R,19R,22R)-8-[(2R,3R,4R,5R,6R)-3-hydroxy-5-[(2S,4S,5S,6S)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-5,19-dimethyl-15,18,20-trioxapentacyclo[14.5.1.04,13.05,10.019,22]docosa-1,10-diene-14,21-dione	present	NPASS
(1R)-1,3,4,5,6,7-Hexahydro-1alpha-methyl-7-(1-methylethylidene)-4abeta(2H)-naphthalenemethanol acetate	present	LOTUS
(1R,4R,6R,9S,12S,17R)-4,9-dihydroxy-3,14-dimethyl-6-prop-1-en-2-yl-11,16,18-trioxatetracyclo[7.6.2.11,4.012,17]octadeca-2,14-dien-10-one	present	LOTUS
(1R,4R,7S,10Z,14R,16S)-4-hydroxy-10,14-dimethyl-7-prop-1-en-2-yl-2,15-dioxatricyclo[12.2.1.04,16]heptadec-10-ene-3,9,12-trione	present	LOTUS
(1S,2R,6R,7R,8aR)-7-hydroxy-6-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4S,5R,6S)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-8a-methyl-1-[3-(2-methylfuran-3-yl)-3-oxopropyl]-2,3,5,6,7,8-hexahydro-1H-naphthalene-2-carboxylic acid	present	NPASS
(1S,4R,10Z,13S,14S)-7,11-dimethyl-4-prop-1-en-2-yl-15,17,18-trioxatetracyclo[11.2.2.16,9.01,14]octadeca-6,8,10-trien-16-one	present	LOTUS
(1S,4R,7Z,10Z,13S,14S)-7,11-dimethyl-4-prop-1-en-2-yl-15,17-dioxatricyclo[11.2.2.01,14]heptadeca-7,10-diene-6,9,16-trione	present	LOTUS
(1S,4S,6S,9R,12R,17S)-4,9-dihydroxy-3,14-dimethyl-6-prop-1-en-2-yl-11,16,18-trioxatetracyclo[7.6.2.11,4.012,17]octadeca-2,14-dien-10-one	present	LOTUS
(1S,4S,7R,10Z,14S,16R)-4-hydroxy-10,14-dimethyl-7-prop-1-en-2-yl-2,15-dioxatricyclo[12.2.1.04,16]heptadec-10-ene-3,9,12-trione	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcyonium coralloides has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P696 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

96Gmostly conserved

261Amostly conserved

528Tmostly conserved

ATGAACAAATATCTTACACGTTGGCTATTTTCTACTAATCATAAGGATATAGGTACTTTATATTTAATATTTGGTGCTTTTTCTGGGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes4

BIN1

Most divergent pair0.29%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcyonium palmatumsame genus1.8%Alcyonium variabilesame genus1.9%Alcyonium haddonisame genus2.0%Alcyonium digitatumsame genus2.2%Alcyonium antarcticumsame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 352 records

Wild obs. + sensor2 219

Museum / vouchered66

Other67

Origin

Native42

Range

Area of Occupancy AOO1 388 km²

Depth

0–200 m sunlit25

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18.9 m · max 117.5 m · 25 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 317≤1 km 120≤10 km 21>10 km 3

461 georeferenced · 1 758 without coordinates

Open the mapobservation + sensor2 219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
AUTHlocation not on record	12
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	4
Paris, FR	2
Barcelona, ES	1
UB_ICMlocation not on record	1
CEFASlocation not on record	1

6 institutions · 21 of 66 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alcyonium coralloides

At a glance

Sources9 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds93 total

At a glance

Record type2 352 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Record type2 352 records