Alcyonium antarcticum

Wright & Studer, 1889 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Alcyonium

At a glance

Occurrence records287

Data sources8

Biological traits4

DNA specimens3

eDNA detections0

Sources8 archives

Databases and archives Alcyonium antarcticum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

OBISOcean Biodiversity Information System136 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS19 compounds

Occurrence & distributionGBIF · OBIS287 records

DNA & barcodingBOLD3 specimens

01Narrative

Alcyonium antarcticum is een zachte koraalsoort uit de familie Alcyoniidae. De koraalsoort komt uit het geslacht Alcyonium. Alcyonium antarcticum werd in 1889 voor het eerst wetenschappelijk beschreven door Wright & studer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max642 m

Depth min18 m

03Chemical composition19 compounds

Compounds documented for Alcyonium antarcticum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Illudalane sesquiterpenoids16

Sterpurane sesquiterpenoids3

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(1S)-5-(2-chloroethyl)-4-(hydroxymethyl)-2,2,6-trimethyl-1,3-dihydroinden-1-ol	present	LOTUS
(3S,6S)-3-(chloromethyl)-4,7,7-trimethyl-1,3,6,8-tetrahydrocyclopenta[e][2]benzofuran-6-ol	present	LOTUS
(3S,6S)-3-(chloromethyl)-6-hydroxy-4,7,7-trimethyl-6,8-dihydro-3H-cyclopenta[g][2]benzofuran-1-one	present	LOTUS
(7S)-5,8,8-trimethyl-3,4,7,9-tetrahydro-1H-cyclopenta[h]isochromen-7-ol	present	LOTUS
5-(2-hydroxyethyl)-2,2,4,6-tetramethyl-3H-inden-1-one	present	LOTUS
[(1R,2R,5R,6S)-5-acetyloxy-8,8,10-trimethyl-2-tricyclo[4.3.2.02,5]undec-10-enyl]methyl acetate	present	LOTUS
[(1R,2S,5S,6S)-5-acetyloxy-8,8,10-trimethyl-2-tricyclo[4.3.2.02,5]undec-10-enyl]methyl acetate	present	LOTUS
[5-(2-Chloroethyl)-2,2,6-trimethyl-1,3-dihydroinden-4-yl]methanol	present	LOTUS
Alcyopterosin A	present	LOTUS
Alcyopterosins O	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcyonium antarcticum has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P756 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TCTAGAGTAAGCATGAACAAATATCTTACACGTTGGCTATTTTCTACTAATCATAAGGATATAGGTACTTTATATTTACTATTTGGTGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sclerophytum pavidumsame order3.0%Sclerophytum tumulosumsame order3.2%Sclerophytum peculiaresame order3.2%Sclerophytum ornatumsame order3.2%Sclerophytum finitimumsame order3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type287 records

Wild obs. + sensor220

Museum / vouchered33

Other34

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit30

200–1000 m twilight15

1–4 km midnight0

>4 km abyssal0

median 150 m · max 618.5 m · 45 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 2≤10 km 1>10 km 2

9 georeferenced · 211 without coordinates

Open the mapobservation + sensor220

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 11≤10 km 2>10 km 2

16 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	4
Cambridge, US	3
Washington, US	2
	2
Museo nazionale dell'Antartidelocation not on record	2
Stockholm, SE	1
University of Oslo (UiO)location not on record	1
WoRMS Editorial Boardlocation not on record	1
Sydney, AU	1

9 institutions · 17 of 33 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)