Alcyonium digitatum

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Alcyoniidae/Alcyonium

At a glance

Occurrence records84 494

Data sources10

Biological traits2

DNA specimens28

eDNA detections545

Sources10 archives

Databases and archives Alcyonium digitatum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 490 records↗

OBISOcean Biodiversity Information System46 004 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI545 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS15 compounds

Occurrence & distributionGBIF · OBIS84 494 records

Environmental DNA3 datasets · 2 countries545 detections

DNA & barcodingBOLD28 specimens

01Narrative

Alcyonium digitatum or dead man's fingers is a species of soft coral in the family Alcyoniidae. It is found around the coasts of the northern Atlantic Ocean and other temperate waters such as the South Pacific.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition15 compounds

Compounds documented for Alcyonium digitatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones4

Dihydroflavonols4

Nagilactone diterpenoids1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-2-(3,4-dihydroxyphenyl)-3-hydroxy-7-methoxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	NPASS
5,7-dihydroxy-2-[4-hydroxy-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyphenyl]chromen-4-one	present	NPASS
5-hydroxy-2-[4-hydroxy-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyphenyl]-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
8-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]-2-(3,4-dihydroxyphenyl)-5-hydroxychromen-4-one	present	NPASS
Aromadendrin 7-methyl ether	present	NPASS
Aromadendrin-7-O-methyl-5-O-beta-D-glucopyranoside	present	NPASS
CLYDDTSYSNAITP-IBYIZXSESA-N	present	NPASS
CTEWBRLWRVXKPE-WQWNGQRRSA-N	present	NPASS
Nagilactone C	present	NPASS
POZDZAFHYWTJCO-GHHVHKICSA-N	present	NPASS

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alcyonium digitatum has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes3

eDNA detections545

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

658Cmostly conserved

TACTTTATATTTACTATTTGGTGCTTTTTCTGGAATGGCGGGGACAGCTTCGAGTATGTTAATACGGCTAGAACTGTCAGCTCCAGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcyonium haddonisame genus1.8%Alcyonium variabilesame genus2.0%Alcyonium coralloidessame genus2.2%Alcyonium antarcticumsame genus2.4%Alcyonium palmatumsame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS18S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061274 ↗ · 14 protein · 1 tRNA · 2 rRNA

ND2ND5ND4COX3ATP6ATP8COX2COX1ND1CYTBND6ND3ND4LmutSrnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type84 494 records

Wild obs. + sensor48 749

Museum / vouchered27 584

Fossil3

Other8 158

Range

Area of Occupancy AOO37 908 km²

Depth

0–200 m sunlit29 127

200–1000 m twilight8

1–4 km midnight0

>4 km abyssal0

median 20.7 m · max 765.6 m · 29 135 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 30 994≤1 km 652≤10 km 3 486>10 km 13

35 145 georeferenced · 13 604 without coordinates

Open the mapobservation + sensor48 749

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 1 115≤1 km 102≤10 km 30>10 km 4

1 251 georeferenced · 26 333 without coordinates

Open the institutions mapphysical evidence27 584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	842
CEFASlocation not on record	823
DASSHlocation not on record	232
RWSlocation not on record	218
Frankfurt am Main	147
NTNU-VMlocation not on record	63
PNHSlocation not on record	54
Gothenburg, SE	39
SLU Artdatabankenlocation not on record	34
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	31
Washington, US	27
South Kensington, GB	10
Stockholm, SE	10
MZLUlocation not on record	8
Museum and Art Gallery of the Northern Territorylocation not on record	8
Cambridge, US	7
Citadel Hill, GB	6
The Atlantic reference Centrelocation not on record	6
Paris, FR	4
University of Oslo (UiO)location not on record	4
Natural History Museum Rotterdamlocation not on record	4
Bergen, NO	3
Tilburg, NL	3
Ilvolocation not on record	2
Natural History Museum, Londonlocation not on record	2
Bergen, NO	2
University Museum of Bergen, Natural History Collectionslocation not on record	1
Barcelona, ES	1
Copenhagen, DK	1
CLOlocation not on record	1
UGentlocation not on record	1
Saint John, CA	1
Santa Barbara Museum of Natural Historylocation not on record	1
EDMO:2110 (Oceana)location not on record	1

34 institutions · 2 597 of 27 584 vouchered records shown · 1 011 without an institution code

09Environmental DNA545 detections

Where the DNA of Alcyonium digitatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found545

Studies independent surveys3

Countries2

Verifiable raw sequence linked542

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 545 detections have coordinates

Open the map2 countries0

North Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–16.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.6 °C 9.10–17.9

Min temp (night)9.90 °C 6.10–14.5

Precipitation94.2 mm/mo 77.6–143

Air humidity64.3 % 63.4–65.2

Vapour deficit507 Pa 368–655

Cloud cover59.5 % 55.9–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 542 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alcyonium digitatum

At a glance

Sources10 archives

Habitat & environment2

Compound class profile3 classes

Documented compounds15 total

At a glance

Record type84 494 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type84 494 records