Alasmidonta varicosa

(Lamarck, 1819) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Alasmidonta

At a glance

Occurrence records364

Data sources8

Biological traits2

DNA specimens40

eDNA detections41

Sources8 archives

Databases and archives Alasmidonta varicosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF364 records

Environmental DNA1 datasets · 1 countries41 detections

DNA & barcodingBOLD40 specimens

01Narrative

The brook floater (also known as swollen wedgmussel), Alasmidonta varicosa, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels. It measures 25.1 mm to 80.2 mm in length although other research also suggests it rarely exceeds three inches (75 mm).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alasmidonta varicosa has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

16Amostly conserved

25Gmostly conserved

61Gmostly conserved

88Gvariable

91Gmostly conserved

100Cvariable

127Cmostly conserved

130Amostly conserved

133Tmostly conserved

202Cmostly conserved

226Cmostly conserved

250Tmostly conserved

286Amostly conserved

319Amostly conserved

373Gmostly conserved

385Tvariable

451Amostly conserved

460Gmostly conserved

550Amostly conserved

553Amostly conserved

628Gvariable

634Tmostly conserved

TACTTTATATTTATTATTTGCTTTGTGGTCAGGCTTAATTGGGTTAGCCTTGAGGCTTTTGATTCGAGCTGAGTTAGGGCAACCAGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes23

BIN1

Most divergent pair3.0%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alasmidonta triangulatasame genus7.1%Alasmidonta undulatasame genus8.1%Alasmidonta arculasame genus8.2%Alasmidonta marginatasame genus8.8%Alasmidonta ravenelianasame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038155 ↗ · 14 protein · 22 tRNA · 2 rRNA

COX3ATP6ATP8ND4LND4ND6ND1ND5CYTBND2HORFND3COX2COX1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type364 records

Wild obs. + sensor27

Museum / vouchered337

Range

Area of Occupancy AOO1 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 5≤1 km 1>10 km 18

24 georeferenced · 3 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤1 km 17≤10 km 26>10 km 7

50 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence337

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	43
Saint John, CA	43
Philadelphia, US	39
The Ohio State University Museum of Biological Diversitylocation not on record	31
Ann Arbor, US	27
Washington, US	25
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	19
Nova Scotia Museum of Natural Historylocation not on record	16
Chongqing Museumlocation not on record	10
Champaign, US	10
Delaware Museum of Nature and Sciencelocation not on record	9
VTFWDlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Montgomery, US	2
New Haven, US	1
Los Angeles, US	1

16 institutions · 284 of 337 vouchered records shown · 53 without an institution code

09Environmental DNA41 detections

Where the DNA of Alasmidonta varicosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 12.3–17.3

Seasonal swing summer↔winter21.0 °C

Max temp (day)19.8 °C 17.3–22.6

Min temp (night)9.70 °C 7.50–13.0

Precipitation99.3 mm/mo 85.7–159

Air humidity58.0 % 56.3–58.6

Moisture balance0.3 mm/mo -10.1–63.6

Vapour deficit742 Pa 689–887

Wind speed2.10 m/s 1.30–3.30

Cloud cover40.9 % 40.1–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)