Alasmidonta triangulata

(I.Lea, 1858) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Alasmidonta

At a glance

Occurrence records58

Data sources5

Biological traits2

DNA specimens16

eDNA detections14

Sources5 archives

Databases and archives Alasmidonta triangulata's data was compiled from.

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD16 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alasmidonta triangulata has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes2

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

43Amostly conserved

55Gmostly conserved

64Tmostly conserved

76Amostly conserved

79Gmostly conserved

88Gmostly conserved

106Cvariable

158Tmostly conserved

160Gmostly conserved

181Gmostly conserved

244Amostly conserved

271Gvariable

274Amostly conserved

319Amostly conserved

349Gmostly conserved

363Cmostly conserved

472Cvariable

481Gmostly conserved

502Gmostly conserved

511Gmostly conserved

520Tmostly conserved

538Gmostly conserved

586Tmostly conserved

592Tmostly conserved

598Gmostly conserved

616Cmostly conserved

625Amostly conserved

649Gmostly conserved

TACTTTATATTTATTATTTGCTTTGTGGTCGGGTTTAATTGGATTGGCTTTAAGGCTTTTAATTCGAGCTGAATTAGGGCAACCAGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BINs2

Most divergent pair0.46%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alasmidonta undulatasame genus3.0%Alasmidonta arculasame genus3.0%Alasmidonta varicosasame genus7.1%Alasmidonta ravenelianasame genus7.8%Alasmidonta marginatasame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor1

Museum / vouchered57

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 1≤1 km 4≤10 km 4>10 km 3

12 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	11
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
The Ohio State University Museum of Biological Diversitylocation not on record	8
Philadelphia, US	8
Washington, US	5
Montgomery, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Ann Arbor, US	2
Delaware Museum of Nature and Sciencelocation not on record	1

9 institutions · 49 of 57 vouchered records shown · 8 without an institution code

09Environmental DNA14 detections

Where the DNA of Alasmidonta triangulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 19.4–19.7

Seasonal swing summer↔winter16.0 °C

Max temp (day)25.2 °C 25.1–25.3

Min temp (night)15.2 °C 14.7–15.6

Precipitation150 mm/mo 113–155

Air humidity59.4 % 57.7–59.7

Moisture balance38.5 mm/mo -5.80–38.5

Vapour deficit957 Pa 954–1,001

Wind speed2.20 m/s 2.10–2.90

Cloud cover39.8 % 38.6–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)