Alasmidonta arcula

(I.Lea, 1838) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Alasmidonta

At a glance

Occurrence records202

Data sources7

Biological traits2

DNA specimens87

eDNA detections89

Sources7 archives

Databases and archives Alasmidonta arcula's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF202 records

Environmental DNA1 datasets · 1 countries89 detections

DNA & barcodingBOLD87 specimens

01Narrative

The Altamaha arcmussel (Alasmidonta arcula) is a species of freshwater mussel, an aquatic bivalve in the family Unionidae. It is an endangered species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alasmidonta arcula has left across the world's sequence archives.

At a glance

DNA specimens87

BINs1

Marker genes2

eDNA detections89

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

39Tvariable

57Amostly conserved

168Amostly conserved

ATTGGTACTTTATATTTGTTATTTGCTTTGTGGTCGGGTTTAATTGGGTTGGCTTTAAGACTTTTAATCCGAGCTGAATTAGGGCAACCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes12

BIN1

Most divergent pair0.62%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alasmidonta undulatasame genus2.9%Alasmidonta triangulatasame genus3.0%Alasmidonta marginatasame genus8.0%Alasmidonta varicosasame genus8.2%Alasmidonta ravenelianasame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type202 records

Wild obs. + sensor2

Museum / vouchered200

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 5≤10 km 6>10 km 1

12 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	23
The Ohio State University Museum of Biological Diversitylocation not on record	12
Cambridge, US	10
Philadelphia, US	5
Los Angeles, US	3
Washington, US	2
Ann Arbor, US	2
Paleontological Research Institutionlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Provincia di Livornolocation not on record	1

10 institutions · 60 of 200 vouchered records shown · 138 without an institution code

09Environmental DNA89 detections

Where the DNA of Alasmidonta arcula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 18.4–27.7

Seasonal swing summer↔winter18.1 °C

Max temp (day)31.8 °C 24.4–33.2

Min temp (night)21.6 °C 14.0–23.2

Precipitation129 mm/mo 85.5–150

Air humidity59.6 % 56.8–61.1

Moisture balance-20.8 mm/mo -59.4–-1.60

Vapour deficit1,353 Pa 964–1,499

Wind speed2.00 m/s 1.70–2.60

Cloud cover34.0 % 28.6–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)