Alasmidonta undulata

(Say, 1817) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Alasmidonta

At a glance

Occurrence records1 302

Data sources7

Biological traits2

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Alasmidonta undulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 302 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 302 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Alasmidonta undulata is een tweekleppigensoort uit de familie van de Unionidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1817 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alasmidonta undulata has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

38Amostly conserved

44Cmostly conserved

47Amostly conserved

59Amostly conserved

74Amostly conserved

77Gmostly conserved

78Tmostly conserved

101Tmostly conserved

113Tmostly conserved

116Gmostly conserved

117Avariable

143Tmostly conserved

146Gmostly conserved

158Gmostly conserved

161Amostly conserved

182Gmostly conserved

188Tmostly conserved

191Cmostly conserved

197Amostly conserved

212Tmostly conserved

221Tmostly conserved

227Gmostly conserved

236Cmostly conserved

237Tmostly conserved

239Gmostly conserved

242Amostly conserved

257Amostly conserved

266Amostly conserved

273Cmostly conserved

281Amostly conserved

317Gmostly conserved

341Gmostly conserved

356Cmostly conserved

368Amostly conserved

371Tmostly conserved

386Tmostly conserved

407Gmostly conserved

428Cmostly conserved

437Tmostly conserved

455Gmostly conserved

515Cmostly conserved

536Gmostly conserved

539Avariable

563Amostly conserved

575Tmostly conserved

581Tmostly conserved

582Cmostly conserved

602Cmostly conserved

605Amostly conserved

608Gmostly conserved

611Tmostly conserved

614Gmostly conserved

617Amostly conserved

629Amostly conserved

635Amostly conserved

TATTTGCTTTGTGGTCGGGTTTAATTGGGTTGGCTTTAAGGCTCTTAATTCGAGCTGAATTAGGGCAACCAGGAAGGTTATTAGGCGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes3

BINs2

Most divergent pair0.62%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alasmidonta arculasame genus2.9%Alasmidonta triangulatasame genus3.0%Alasmidonta ravenelianasame genus7.6%Alasmidonta varicosasame genus8.1%Lasmigona compressasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 302 records

Wild obs. + sensor90

Museum / vouchered1 212

Range

Area of Occupancy AOO4 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 31≤1 km 4≤10 km 1>10 km 34

70 georeferenced · 20 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 18≤1 km 212≤10 km 172>10 km 38

440 georeferenced · 772 without coordinates

Open the institutions mapphysical evidence1 212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina Museum of Natural Scienceslocation not on record	258
Cambridge, US	237
Champaign, US	116
Washington, US	100
The Ohio State University Museum of Biological Diversitylocation not on record	91
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	85
Philadelphia, US	68
Saint John, CA	62
Delaware Museum of Nature and Sciencelocation not on record	46
VTFWDlocation not on record	44
Nova Scotia Museum of Natural Historylocation not on record	37
Toronto, CA	21
Chongqing Museumlocation not on record	15
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Chicago, US	3
Auckland, NZ	3
Los Angeles, US	3
Ann Arbor, US	3
Chicago, US	2
New Haven, US	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Montgomery, US	1
Frankfurt am Main	1

23 institutions · 1 206 of 1 212 vouchered records shown · 6 without an institution code

09Environmental DNA8 detections

Where the DNA of Alasmidonta undulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alasmidonta undulata

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 302 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 302 records