Agyneta simplicitarsis

(Simon, 1884) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records1 316

Data sources8

Biological traits14

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Agyneta simplicitarsis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

World Spider Trait DBMasaryk University14 traits · 14 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements14 literature sources14 traits

Occurrence & distributionGBIF1 316 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Agyneta simplicitarsis is a species of sheet weaver found in Europe, Kazakhstan and Russia. It was described by Simon in 1884.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 14 sources

Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001Liste France 2018Harvey et al. 2017Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Buchholz et al. 2011Nentwig et al. 2018Cardoso et al. 2011

Morphometry5

Body length♀1.65·♂1.65 mm

Cephalothorax height0.28 mm

Cephalothorax length0.77 mm

Cephalothorax width0.53 mm

Fang length0.18 mm

Predation1

Hunting guildsheet web weavers

Ecology8

Circadian activity0.5 mm

Light0.625 mm

Light 2open

Moisture 10.375 mm

Moisture 2very dry

Regional IUCN Red List categoryData Deficient (DD)

Regional non-IUCN Red List categoryCritically Endangered (CR)

Stratum0 mm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta simplicitarsis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

552Tmostly conserved

TTATATTTTATTTTTGGAGCCTGAGCGGCTATAGTTGGTACAGCAATAAGAGTATTAATTCGAATTGAATTAGGACAAATTGGTAGATTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta mollissame genus7.2%Agyneta simplexsame genus8.7%Agyneta affinissame genus8.9%Agyneta saxatilissame genus9.2%Agyneta nigripessame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 316 records

Wild obs. + sensor1 200

Museum / vouchered111

Other5

Origin

Native462

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 62≤1 km 15≤10 km 944>10 km 1

1 022 georeferenced · 178 without coordinates

Open the mapobservation + sensor1 200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 1≤10 km 72

74 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	30
Musee d'Histoire Naturallelocation not on record	26
EIBElocation not on record	9
LEBAlocation not on record	6
Geneva, CH	4
Ekaterinburg, RU	2
Washington, US	2

7 institutions · 79 of 111 vouchered records shown · 31 without an institution code

09Environmental DNA6 detections

Where the DNA of Agyneta simplicitarsis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

in grassUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.50 °C 0.7–15.5

Seasonal swing summer↔winter21.5 °C

Max temp (day)6.00 °C 5.00–19.6

Min temp (night)-3.40 °C -3.80–10.2

Precipitation47.4 mm/mo 41.4–112

Air humidity59.7 % 58.5–63.6

Moisture balance6.70 mm/mo -18.4–21.9

Vapour deficit279 Pa 238–793

Wind speed2.30 m/s 1.90–2.90

Cloud cover54.5 % 39.7–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta simplicitarsis

At a glance

Sources8 archives

Morphometry5

Predation1

Ecology8

At a glance

Record type1 316 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 316 records