Agyneta nigripes

(Simon, 1884) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records224

Data sources8

Biological traits2

DNA specimens20

eDNA detections10

Sources8 archives

Databases and archives Agyneta nigripes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

World Spider Trait DBMasaryk University2 traits · 6 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements6 literature sources2 traits

Occurrence & distributionGBIF224 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD20 specimens

01Narrative

Agyneta nigripes is a species of sheet weaver found in Canada, Greenland and the Palearctic. It was described by Simon in 1884.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesHyvärinen et al. 2019Harvey et al. 2017Henriksen & Hilmo 2015SLU 2020Komposch & Steinberger 1999Noflatscher 1994

Ecology2

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryData Deficient (?)

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta nigripes has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 127 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Gmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

14Amostly conserved

15Tmostly conserved

16Tvariable

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

22Amostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Gmostly conserved

33Cmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Tmostly conserved

42Gmostly conserved

43Amostly conserved

45Cmostly conserved

46Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Gvariable

50Amostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

56Gmostly conserved

58Gvariable

59Tmostly conserved

60Tmostly conserved

61Gmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

70Tmostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Avariable

80Cmostly conserved

81Amostly conserved

82Amostly conserved

84Cmostly conserved

97Amostly conserved

100Gvariable

127Amostly conserved

130Amostly conserved

145Gvariable

163Avariable

169Tvariable

178Cvariable

181Gmostly conserved

184Gmostly conserved

190Tvariable

193Tvariable

196Gmostly conserved

199Amostly conserved

202Amostly conserved

211Gvariable

214Gmostly conserved

217Gvariable

220Tvariable

223Avariable

229Amostly conserved

232Avariable

244Avariable

262Gmostly conserved

263Tmostly conserved

271Tvariable

307Tvariable

316Gmostly conserved

325Tmostly conserved

328Amostly conserved

331Gvariable

337Tmostly conserved

343Cvariable

350Gmostly conserved

355Tmostly conserved

356Tvariable

361Gmostly conserved

364Tmostly conserved

397Tvariable

409Gmostly conserved

415Tvariable

417Cmostly conserved

421Avariable

430Avariable

433Gmostly conserved

442Tmostly conserved

445Tmostly conserved

455Amostly conserved

458Tvariable

472Cvariable

478Tmostly conserved

496Tmostly conserved

511Gvariable

514Tvariable

517Tvariable

544Amostly conserved

556Gmostly conserved

559Gvariable

565Gmostly conserved

577Avariable

+7 more variable positions not shown

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGAACAGCGATAAGAGTGTTGATTCGAATTGAATTAGGACAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.7%

Haplotypes6

BINs2

Most divergent pair7.1%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta rurestrissame genus4.6%Agyneta jacksonisame genus4.6%Agyneta resslisame genus4.9%Agyneta maritimasame genus5.8%Agyneta mollissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type224 records

Wild obs. + sensor150

Museum / vouchered74

Origin

Native15

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 78≤1 km 36≤10 km 36

150 georeferenced

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 10≤1 km 20≤10 km 17>10 km 3

50 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	16
AU-Biosciencelocation not on record	8
SLU Artdatabankenlocation not on record	5
Cambridge, US	4
University of Copenhagen, Natural History Museum of Denmarklocation not on record	4
Tromso University Museumlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	3
Chicago, US	3
NTNU-VMlocation not on record	1

11 institutions · 69 of 74 vouchered records shown · 5 without an institution code

09Environmental DNA10 detections

Where the DNA of Agyneta nigripes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

Lichens on rocksFell-field in the high mountains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.80 °C 5.40–7.00

Seasonal swing summer↔winter21.5 °C

Max temp (day)7.10 °C 5.80–9.50

Min temp (night)3.00 °C 1.20–3.80

Precipitation42.0 mm/mo 31.5–126

Air humidity65.1 % 62.4–66.8

Moisture balance-23.7 mm/mo -41.5–57.2

Vapour deficit322 Pa 297–360

Wind speed3.40 m/s 3.00–6.10

Cloud cover62.9 % 47.8–77.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)