Agyneta rurestris

(C.L.Koch, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records18 711

Data sources9

Biological traits16

DNA specimens62

eDNA detections3

Sources9 archives

Databases and archives Agyneta rurestris's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 711 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

World Spider Trait DBMasaryk University16 traits · 25 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements25 literature sources16 traits

Occurrence & distributionGBIF18 711 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD62 specimens

01Narrative

Agyneta rurestris is a species of sheet weaver found in the Palearctic. It was described by C. L. Koch in 1836.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 25 sources

Simonneau et al. 2016Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Staręga et al. 2001SLU 2020Henriksen & Hilmo 2015Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀2.08·♂1.85 mm

Cephalothorax height♀0.23·♂0.28 mm

Cephalothorax length♀0.785·♂0.84 mm

Cephalothorax width♀0.555·♂0.6 mm

Fang length♀0.145·♂0.23 mm

Tibia I length♀0.73·♂0.76 mm

Predation1

Hunting guildsheet web weavers

Ecology9

Ballooningyes

Circadian activity1 mm

Light0.875 mm

Light 2open

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEcologically Sustainable (ES)

Stratum0.33 mm

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta rurestris has left across the world's sequence archives.

At a glance

DNA specimens62

BINs1

Marker genes1

eDNA detections3

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

61Gmostly conserved

145Gmostly conserved

169Tmostly conserved

181Tmostly conserved

190Amostly conserved

196Gmostly conserved

197Tmostly conserved

223Tmostly conserved

263Cvariable

364Tmostly conserved

412Tmostly conserved

451Tmostly conserved

478Amostly conserved

565Gmostly conserved

616Tmostly conserved

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGAACAGCGATAAGAGTATTGATTCGAATTGAATTAGGGCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes16

BIN1

Most divergent pair18.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta nigripessame genus4.6%Agyneta maritimasame genus7.2%Agyneta gulosasame genus7.5%Agyneta mollissame genus7.6%Agyneta dynicasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 711 records

Wild obs. + sensor12 501

Museum / vouchered6 182

Other28

Origin

Native4 623

Range

Area of Occupancy AOO12 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 1 611≤1 km 316≤10 km 8 136>10 km 28

10 091 georeferenced · 2 410 without coordinates

Open the mapobservation + sensor12 501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 232≤1 km 71≤10 km 2 475>10 km 32

2 810 georeferenced · 3 372 without coordinates

Open the institutions mapphysical evidence6 182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2 789
Helsinki, FI	129
LEBAlocation not on record	126
Akademia Pomorska w Słupskulocation not on record	118
Paro, BT	102
Adam Mickiewicz University in Poznańlocation not on record	100
	94
SLU Artdatabankenlocation not on record	59
Zoologisches Museum Hamburglocation not on record	41
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	34
Bern, CH	32
Ekaterinburg, RU	32
Bonn, DE	31
Musee d'Histoire Naturallelocation not on record	29
ARTlocation not on record	29
NTNU-VMlocation not on record	25
Geneva, CH	13
SNSDlocation not on record	13
Frankfurt am Main	11
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	6
EIBElocation not on record	6
Ghent, BE	6
Uniwersytet w Białymstokulocation not on record	5
Cambridge, US	5
Washington, US	3
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	3
Tilburg, NL	3
BioFokuslocation not on record	2
Edmonton, CA	2
Personal Collection Grant R Brownlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	2
Tartu, EE	1
Centre for Biodiversity Genomicslocation not on record	1
SGAV-and-NHMDlocation not on record	1

35 institutions · 3 857 of 6 182 vouchered records shown · 2 324 without an institution code

09Environmental DNA3 detections

Where the DNA of Agyneta rurestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Patch of brownfield/weedy gravel

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–13.4

Seasonal swing summer↔winter10.4 °C

Max temp (day)8.70 °C 8.70–16.4

Min temp (night)4.80 °C 4.80–9.20

Precipitation71.2 mm/mo 60.9–71.2

Air humidity65.2 % 61.8–65.2

Vapour deficit357 Pa 357–598

Cloud cover51.3 % 45.9–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta rurestris

At a glance

Sources9 archives

Morphometry6

Predation1

Ecology9

At a glance

Record type18 711 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type18 711 records