Agyneta gulosa

(L.Koch, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records702

Data sources8

Biological traits4

DNA specimens16

eDNA detections22

Sources8 archives

Databases and archives Agyneta gulosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility702 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

World Spider Trait DBMasaryk University4 traits · 16 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements16 literature sources4 traits

Occurrence & distributionGBIF702 records

Environmental DNA3 datasets · 6 countries22 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agyneta gulosa is a species of sheet weaver found in the Palearctic. It was described by L. Koch in 1896.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 16 sources

Hyvärinen et al. 2019Harvey et al. 2017Henriksen & Hilmo 2015SLU 2020Gajdoš & Svatoň 2001Gajdoš et al. 2014Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Buchholz et al. 2011Sacher & Platen 2004Lemke et al. 2013Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.9·♂1.9 mm

Predation1

Hunting guildsheet web weavers

Ecology2

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta gulosa has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections22

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

58Gmostly conserved

70Gmostly conserved

124Gvariable

160Avariable

170Cvariable

187Cvariable

208Amostly conserved

214Gmostly conserved

259Gvariable

260Tmostly conserved

332Gmostly conserved

340Tmostly conserved

370Tmostly conserved

382Tvariable

409Amostly conserved

433Tmostly conserved

472Tvariable

475Gmostly conserved

493Tmostly conserved

508Amostly conserved

589Tmostly conserved

TTTATATTTTATTTTTGGGGCCTGAGCGGCTATAGTTGGTACGGCAATAAGAGTATTGATTCGAATTGAGTTAGGGCAAACTGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes9

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta dynicasame genus2.0%Agyneta mollissame genus6.6%Agyneta rurestrissame genus7.5%Agyneta jacksonisame genus7.5%Agyneta resslisame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type702 records

Wild obs. + sensor483

Museum / vouchered219

Origin

Native110

Range

Area of Occupancy AOO1 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 105≤1 km 81≤10 km 294>10 km 2

482 georeferenced · 1 without coordinates

Open the mapobservation + sensor483

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 36≤1 km 38≤10 km 69>10 km 30

173 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	114
Ekaterinburg, RU	24
SLU Artdatabankenlocation not on record	21
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	17
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	16
Rovaniemi, FI	4
University of Copenhagen, Natural History Museum of Denmarklocation not on record	3
Washington, US	3
NTNU-VMlocation not on record	2
Uniwersytet w Białymstokulocation not on record	1
Cambridge, US	1

11 institutions · 206 of 219 vouchered records shown · 13 without an institution code

09Environmental DNA22 detections

Where the DNA of Agyneta gulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys3

Countries6

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map6 countries0

alpine17. Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 5.00–15.1

Seasonal swing summer↔winter20.9 °C

Max temp (day)12.7 °C 8.90–19.4

Min temp (night)6.40 °C 0.2–9.50

Precipitation123 mm/mo 74.8–179

Air humidity61.7 % 59.4–63.8

Moisture balance25.5 mm/mo -13.5–79.3

Vapour deficit468 Pa 304–668

Wind speed3.20 m/s 2.00–6.10

Cloud cover41.6 % 37.0–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)