Agyneta affinis

(Kulczyński, 1898) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records2 761

Data sources9

Biological traits12

DNA specimens21

eDNA detections29

Sources9 archives

Databases and archives Agyneta affinis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 761 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

World Spider Trait DBMasaryk University12 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources12 traits

Occurrence & distributionGBIF2 761 records

Environmental DNA2 datasets · 5 countries29 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agyneta affinis is a species of sheet weaver found in the Palearctic. It was described by Kulczynski in 1898.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Pekár 2014bBirkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Henriksen & Hilmo 2015SLU 2020Staręga et al. 2001Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.75·♂1.75 mm

Predation2

Hunting guildsheet web weavers

Simple hunting guild classificationcursorial

Ecology8

Ballooninghigh

Light0.625 mm

Light 2semi-open

Moisture 10.5 mm

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (EN)

Stratumvegetation

Defence1

Primary defenceBatesian mimicry

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta affinis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections29

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

66Tmostly conserved

105Cvariable

147Amostly conserved

219Cvariable

294Tvariable

303Amostly conserved

342Cmostly conserved

372Gvariable

390Cmostly conserved

483Tvariable

507Tmostly conserved

538Cmostly conserved

612Tmostly conserved

636Tvariable

639Cmostly conserved

AGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGTACAGCAATAAGAGTATTAATTCGTATTGAGTTAGGACAAACGGGTAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes5

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta mollissame genus7.6%Agyneta simplexsame genus8.1%Agyneta saxatilissame genus8.8%Agyneta simplicitarsissame genus8.9%Agyneta mossicasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 761 records

Wild obs. + sensor1 508

Museum / vouchered1 253

Origin

Native457

Range

Area of Occupancy AOO2 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 456≤1 km 91≤10 km 748>10 km 4

1 299 georeferenced · 209 without coordinates

Open the mapobservation + sensor1 508

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 84≤1 km 139≤10 km 164>10 km 29

416 georeferenced · 837 without coordinates

Open the institutions mapphysical evidence1 253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	346
Helsinki, FI	324
Adam Mickiewicz University in Poznańlocation not on record	228
Ekaterinburg, RU	31
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	28
SLU Artdatabankenlocation not on record	17
Bonn, DE	16
Zoologisches Museum Hamburglocation not on record	14
Akademia Pomorska w Słupskulocation not on record	14
Rovaniemi, FI	10
Uniwersytet w Białymstokulocation not on record	9
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	7
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	6
EIBElocation not on record	4
Tilburg, NL	4
NTNU-VMlocation not on record	3
Washington, US	3
Prioksko-Terrasnyi Biosphere Reservelocation not on record	3
Paro, BT	2
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	2
Tartu, EE	2
University of Tokyo, Department of Zoologylocation not on record	1
Metsähallituslocation not on record	1
BioFokuslocation not on record	1
South Kensington, GB	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1

27 institutions · 1 079 of 1 253 vouchered records shown · 174 without an institution code

09Environmental DNA29 detections

Where the DNA of Agyneta affinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries5

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map5 countries0

meadow and forestWiese, in MoosWiese un MoosStreuobstwiese14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 9.50–17.2

Seasonal swing summer↔winter19.7 °C

Max temp (day)16.8 °C 13.8–21.8

Min temp (night)8.60 °C 4.20–13.1

Precipitation76.5 mm/mo 47.4–114

Air humidity59.8 % 56.1–64.0

Moisture balance-32.6 mm/mo -50.2–54.3

Vapour deficit683 Pa 451–807

Wind speed2.60 m/s 2.40–4.20

Cloud cover46.3 % 38.1–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta affinis

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology8

Defence1

At a glance

Record type2 761 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 761 records