Agyneta saxatilis

(Blackwall, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records1 494

Data sources8

Biological traits8

DNA specimens11

eDNA detections1

Sources8 archives

Databases and archives Agyneta saxatilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 494 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University8 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources8 traits

Occurrence & distributionGBIF1 494 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD11 specimens

01Narrative

Agyneta saxatilis is a species of sheet weaver found in Europe and Russia. It was described by Blackwall in 1844.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Entling et al. 2007Buchar & Růžička 2002Bruun & Lissner 2019SLU 2020Gajdoš et al. 2014Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Gajdoš & Svatoň 2001Kielhorn 2017Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Finch 2004Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.15·♂2.15 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.625 mm

Light 2partly shaded

Moisture 10.625 mm

Moisture 2humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta saxatilis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

1Avariable

22Amostly conserved

25Tmostly conserved

43Gmostly conserved

73Gvariable

79Tmostly conserved

84Cmostly conserved

97Amostly conserved

103Tmostly conserved

106Cvariable

127Gvariable

130Amostly conserved

166Gmostly conserved

184Amostly conserved

190Tmostly conserved

199Amostly conserved

202Avariable

205Tmostly conserved

208Gmostly conserved

214Amostly conserved

217Amostly conserved

271Gvariable

280Amostly conserved

284Tvariable

286Avariable

298Tmostly conserved

301Tvariable

310Avariable

316Avariable

322Gmostly conserved

325Amostly conserved

328Amostly conserved

331Amostly conserved

334Tmostly conserved

337Avariable

340Tvariable

343Cvariable

353Tmostly conserved

355Cvariable

361Gvariable

364Tvariable

370Tmostly conserved

373Tvariable

400Tmostly conserved

406Tmostly conserved

409Amostly conserved

415Avariable

427Cmostly conserved

433Avariable

442Tmostly conserved

448Tmostly conserved

466Amostly conserved

481Avariable

484Avariable

490Gmostly conserved

496Tmostly conserved

502Avariable

508Tmostly conserved

511Gmostly conserved

526Gmostly conserved

532Amostly conserved

536Cmostly conserved

562Amostly conserved

577Amostly conserved

580Amostly conserved

581Cvariable

592Tmostly conserved

604Gmostly conserved

619Tmostly conserved

620Gmostly conserved

628Avariable

631Gvariable

649Avariable

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGGACAGCAATAAGAGTATTAATTCGAATTGAGTTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.5%

Haplotypes3

BINs3

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta amersaxatilissame genus1.8%Agyneta mollissame genus5.3%Agyneta simplexsame genus8.5%Agyneta affinissame genus8.8%Agyneta simplicitarsissame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 494 records

Wild obs. + sensor1 151

Museum / vouchered343

Origin

Native181

Range

Area of Occupancy AOO2 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 379≤1 km 106≤10 km 574>10 km 3

1 062 georeferenced · 89 without coordinates

Open the mapobservation + sensor1 151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 17≤1 km 5≤10 km 171>10 km 4

197 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence343

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	69
Paro, BT	36
	18
Helsinki, FI	18
Bonn, DE	10
SLU Artdatabankenlocation not on record	9
Ekaterinburg, RU	7
Adam Mickiewicz University in Poznańlocation not on record	6
BioFokuslocation not on record	5
ARTlocation not on record	4
Natural History Museum, Londonlocation not on record	4
Tilburg, NL	4
Washington, US	3
Bern, CH	2
Geneva, CH	2
Zoologisches Museum Hamburglocation not on record	2
Midt-Troms Museumlocation not on record	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
Tartu, EE	1
SNSDlocation not on record	1
Frankfurt am Main	1
Akademia Pomorska w Słupskulocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

24 institutions · 208 of 343 vouchered records shown · 135 without an institution code

09Environmental DNA1 detections

Where the DNA of Agyneta saxatilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.7–17.7

Seasonal swing summer↔winter18.8 °C

Max temp (day)21.7 °C

Min temp (night)12.2 °C

Precipitation112 mm/mo

Air humidity57.7 %

Moisture balance-40.2 mm/mo

Vapour deficit858 Pa

Wind speed3.80 m/s

Cloud cover36.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta saxatilis

At a glance

Sources8 archives

Morphometry1

Predation1

Ecology6

At a glance

Record type1 494 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 494 records