Agyneta mossica

(Schikora, 1993) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records613

Data sources7

Biological traits4

DNA specimens23

eDNA detections0

Sources7 archives

Databases and archives Agyneta mossica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility613 records↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University4 traits · 13 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements13 literature sources4 traits

Occurrence & distributionGBIF613 records

DNA & barcodingBOLD23 specimens

01Narrative

Agyneta mossica is a species of sheet weaver found in Europe. It was described by Schikora in 1993.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 13 sources

Hyvärinen et al. 2019Harvey et al. 2017Henriksen & Hilmo 2015SLU 2020Gajdoš et al. 2014Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Martin 2012Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.85·♂1.89 mm

Predation1

Hunting guildsheet web weavers

Ecology2

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (2)

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta mossica has left across the world's sequence archives.

At a glance

DNA specimens23

BINs5

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

1Amostly conserved

22Amostly conserved

43Gmostly conserved

106Cmostly conserved

127Gmostly conserved

190Tmostly conserved

271Thighly variable

286Amostly conserved

301Tmostly conserved

310Amostly conserved

337Avariable

340Tmostly conserved

343Cvariable

355Cmostly conserved

361Gvariable

364Tvariable

373Tvariable

391Tmostly conserved

415Amostly conserved

427Cmostly conserved

451Tmostly conserved

478Tmostly conserved

481Avariable

484Gvariable

490Gmostly conserved

502Gvariable

532Amostly conserved

536Cmostly conserved

556Tmostly conserved

581Tmostly conserved

616Tvariable

628Gvariable

646Cmostly conserved

649Gvariable

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGGACAGCAATAAGAGTATTAATTCGAATTGAGTTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes9

BINs5

Most divergent pair4.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta amersaxatilissame genus1.5%Agyneta mollissame genus5.8%Agyneta simplexsame genus8.8%Agyneta affinissame genus9.0%Agyneta nigripessame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type613 records

Wild obs. + sensor157

Museum / vouchered456

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 84≤1 km 55≤10 km 17

156 georeferenced · 1 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 67≤1 km 25≤10 km 43>10 km 7

142 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence456

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adam Mickiewicz University in Poznańlocation not on record	213
Helsinki, FI	90
Akademia Pomorska w Słupskulocation not on record	23
SLU Artdatabankenlocation not on record	22
Ekaterinburg, RU	11
Rovaniemi, FI	11
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	8
Uniwersytet w Białymstokulocation not on record	2
NTNU-VMlocation not on record	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1

10 institutions · 382 of 456 vouchered records shown · 74 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)