Agyneta conigera

(O.Pickard-Cambridge, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records2 369

Data sources8

Biological traits13

DNA specimens17

eDNA detections167

Sources8 archives

Databases and archives Agyneta conigera's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 369 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI167 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University13 traits · 27 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements27 literature sources13 traits

Occurrence & distributionGBIF2 369 records

Environmental DNA4 datasets · 6 countries167 detections

DNA & barcodingBOLD17 specimens

01Narrative

Agyneta conigera is a species of sheet weaver found in the Palearctic and Congo. It was described by O.P.-Cambridge in 1863.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 27 sources

Schirmel et al. 2012Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Liste France 2018Bruun & Lissner 2019Gajdoš & Svatoň 2001Staręga et al. 2001Gajdoš et al. 2014SLU 2020Henriksen & Hilmo 2015Harvey et al. 2017Hyvärinen et al. 2019Maelfait et al. 1998Lemke et al. 2013Sacher & Platen 2004Hiebsch & Tolke 1996Buchholz et al. 2011Martin 2012Noflatscher 1994Finch 2004Kielhorn 2017Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.05·♂2.05 mm

Predation4

Hunting guildsheet web weavers

Simple hunting guild IIweb

Simple hunting guild classificationcursorial

Web buildingyes

Ecology8

Ballooningless common

Light0.5 mm

Light 2shaded

Moisture 10.625 mm

Moisture 2humid

Regional IUCN Red List categoryData Deficient (DD)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratumsurface

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta conigera has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections167

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

1Gmostly conserved

5Tmostly conserved

10Cvariable

73Avariable

106Cmostly conserved

154Tmostly conserved

170Amostly conserved

235Tvariable

262Avariable

271Tvariable

337Amostly conserved

343Tvariable

370Gvariable

373Gvariable

421Tmostly conserved

426Tmostly conserved

478Tmostly conserved

496Amostly conserved

553Tvariable

571Cvariable

574Gvariable

616Cmostly conserved

631Gvariable

640Cmostly conserved

646Cmostly conserved

GAGTTTATACTTTATTTTTGGGGCTTGAGCGGCTATAGTGGGTACAGCGATAAGAGTATTAATTCGGGTTGAATTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair2.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta bulavintsevisame genus10.2%Agyneta innotabilissame genus10.4%Agyneta perspicuasame genus10.6%Agyneta affinissame genus11.0%Agyneta cautasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 369 records

Wild obs. + sensor1 048

Museum / vouchered1 314

Cultivated / captive2

Other5

Origin

Native134

Range

Area of Occupancy AOO3 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 304≤1 km 196≤10 km 512>10 km 3

1 015 georeferenced · 33 without coordinates

Open the mapobservation + sensor1 048

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 216≤1 km 429≤10 km 250>10 km 177

1 072 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence1 314

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	782
Brussels, BE	104
Ekaterinburg, RU	51
SLU Artdatabankenlocation not on record	51
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	37
Edmonton, CA	35
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	28
Akademia Pomorska w Słupskulocation not on record	19
Copenhagen, DK	14
Metsähallituslocation not on record	13
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	13
NTNU-VMlocation not on record	11
Uniwersytet w Białymstokulocation not on record	10
Tartu, EE	7
University of Tokyo, Department of Zoologylocation not on record	6
Bonn, DE	6
Tilburg, NL	5
Bern, CH	4
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	4
BioFokuslocation not on record	4
NHMOlocation not on record	4
Washington, US	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
Rovaniemi, FI	1
Provincia di Livornolocation not on record	1
MZLUlocation not on record	1
neflocation not on record	1
Cambridge, US	1

30 institutions · 1 221 of 1 314 vouchered records shown · 93 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA167 detections

Where the DNA of Agyneta conigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found167

Studies independent surveys4

Countries6

Verifiable raw sequence linked150

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 167 detections have coordinates

Open the map6 countries0

alpine4. Native Grassland | 4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 9.00–15.3

Seasonal swing summer↔winter23.8 °C

Max temp (day)16.8 °C 12.6–19.0

Min temp (night)10.0 °C 5.20–12.2

Precipitation90.2 mm/mo 72.0–116

Air humidity60.6 % 55.8–62.1

Moisture balance10.1 mm/mo -32.2–33.1

Vapour deficit613 Pa 464–723

Wind speed2.50 m/s 1.80–3.20

Cloud cover53.2 % 47.3–57.3

CHELSA 1981–2010, ~9 km grid, at location & month of 167 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta conigera

At a glance

Sources8 archives

Morphometry1

Predation4

Ecology8

At a glance

Record type2 369 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 369 records