Agyneta innotabilis

(O.Pickard-Cambridge, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records291

Data sources8

Biological traits8

DNA specimens14

eDNA detections28

Sources8 archives

Databases and archives Agyneta innotabilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

World Spider Trait DBMasaryk University8 traits · 22 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements22 literature sources8 traits

Occurrence & distributionGBIF291 records

Environmental DNA3 datasets · 5 countries28 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agyneta innotabilis is a species of sheet weaver found in Europe and Russia. It was described by O.P.-Cambridge in 1863.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 22 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Hyvärinen et al. 2019Bruun & Lissner 2019Kielhorn 2017Finch 2004Buchholz et al. 2011Hiebsch & Tolke 1996Lemke et al. 2013Liste France 2018Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.15·♂2.05 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.25 mm

Light 2shaded

Moisture 10.75 mm

Moisture 2semi-humid

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta innotabilis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections28

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes1

BIN1

Where individuals differ — all 62 variable positions, in barcode order

1Gvariable

2Avariable

3Gmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

22Gmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Gmostly conserved

33Cmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Tmostly conserved

42Gmostly conserved

43Tmostly conserved

45Cmostly conserved

47Gmostly conserved

48Cmostly conserved

49Gmostly conserved

50Amostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

70Tmostly conserved

72Amostly conserved

73Gmostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

82Amostly conserved

84Tmostly conserved

100Gmostly conserved

184Gmostly conserved

208Amostly conserved

218Gvariable

300Gmostly conserved

322Cvariable

346Tmostly conserved

GAGTTTATATTTTATTTTTGGGGCTTGAGCGGCTATAGTTGGTACAGCGATAAGAGTATTAATTCGAATTGAGTTAGGTCAAATTGGCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta bulavintsevisame genus9.6%Agyneta perspicuasame genus9.6%Agyneta mollissame genus9.6%Agyneta resslisame genus9.6%Agyneta jacksonisame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type291 records

Wild obs. + sensor155

Museum / vouchered136

Origin

Native16

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 75≤1 km 22≤10 km 56

153 georeferenced · 2 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 28≤1 km 9≤10 km 16>10 km 1

54 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	38
Helsinki, FI	18
SLU Artdatabankenlocation not on record	17
Copenhagen, DK	10
Bonn, DE	7
Metsähallituslocation not on record	6
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	6
Ekaterinburg, RU	3
Washington, US	3
NTNU-VMlocation not on record	2
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	2
Rovaniemi, FI	1
BioFokuslocation not on record	1
Tartu, EE	1

14 institutions · 115 of 136 vouchered records shown · 21 without an institution code

09Environmental DNA28 detections

Where the DNA of Agyneta innotabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys3

Countries5

Verifiable raw sequence linked15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map5 countries0

Under bark, dead spruceNadelforst, unter RindenschuppenMischwald, unter Eindenschuppen von NadelbÃ¤…Kiefernmischwald, an/unter Kieferrinde

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 2.20–15.0

Seasonal swing summer↔winter19.9 °C

Max temp (day)14.7 °C 4.20–18.6

Min temp (night)6.40 °C -0.2–12.2

Precipitation68.3 mm/mo 52.1–103

Air humidity58.6 % 56.9–66.3

Moisture balance-7.60 mm/mo -52.1–35.7

Vapour deficit561 Pa 228–691

Wind speed2.70 m/s 2.20–4.00

Cloud cover51.7 % 40.8–61.7

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)