Agyneta cauta

(O.Pickard-Cambridge, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records2 521

Data sources8

Biological traits11

DNA specimens30

eDNA detections31

Sources8 archives

Databases and archives Agyneta cauta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 521 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

World Spider Trait DBMasaryk University11 traits · 27 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements27 literature sources11 traits

Occurrence & distributionGBIF2 521 records

Environmental DNA3 datasets · 5 countries31 detections

DNA & barcodingBOLD30 specimens

01Narrative

Agyneta cauta is a species of sheet weaver found in the Palearctic. It was described by O.P.-Cambridge in 1902.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 27 sources

Schirmel et al. 2012Simonneau et al. 2016Entling et al. 2007Buchar & Růžička 2002Henriksen & Hilmo 2015Gajdoš & Svatoň 2001SLU 2020Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Komposch & Steinberger 1999Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Noflatscher 1994Nährig et al. 2003Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.5·♂2.5 mm

Predation3

Hunting guildsheet web weavers

Simple hunting guild IIweb

Web buildingyes

Ecology7

Ballooningless common

Light0.625 mm

Light 2semi-open

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryNear Threatened (V)

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta cauta has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections31

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

67Amostly conserved

84Cmostly conserved

118Tvariable

170Amostly conserved

235Tvariable

263Tmostly conserved

266Tmostly conserved

328Avariable

340Tvariable

417Cmostly conserved

436Tmostly conserved

442Tmostly conserved

493Amostly conserved

577Gmostly conserved

631Amostly conserved

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGTACTGCAATAAGAGTATTAATTCGAATTGAATTAGGTCAAACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes5

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta olivaceasame genus3.5%Agyneta decorasame genus6.8%Agyneta bulavintsevisame genus7.3%Agyneta trifurcatasame genus8.1%Agyneta subtilissame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 521 records

Wild obs. + sensor700

Museum / vouchered1 817

Other4

Origin

Native163

Range

Area of Occupancy AOO2 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 294≤1 km 90≤10 km 291>10 km 3

678 georeferenced · 22 without coordinates

Open the mapobservation + sensor700

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 250≤1 km 162≤10 km 319>10 km 41

772 georeferenced · 1 045 without coordinates

Open the institutions mapphysical evidence1 817

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	719
Adam Mickiewicz University in Poznańlocation not on record	341
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	224
Bern, CH	145
Akademia Pomorska w Słupskulocation not on record	126
NTNU-VMlocation not on record	23
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	22
Uniwersytet w Białymstokulocation not on record	19
Rovaniemi, FI	14
Brussels, BE	12
SLU Artdatabankenlocation not on record	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Tartu, EE	6
Provincia di Livornolocation not on record	5
University of Tokyo, Department of Zoologylocation not on record	4
Metsähallituslocation not on record	4
NTNU University Museum, Department of Natural Historylocation not on record	4
Bonn, DE	3
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	3
	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Washington, US	2
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Yes. Philip Colyer 13.02.2021location not on record	1
Research Collection of Ari Kakkolocation not on record	1
University of Oulu, Zoological Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1

30 institutions · 1 707 of 1 817 vouchered records shown · 110 without an institution code

09Environmental DNA31 detections

Where the DNA of Agyneta cauta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys3

Countries5

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map5 countries0

WetlandForestmeadow and shrubs at stream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 9.90–13.6

Seasonal swing summer↔winter26.2 °C

Max temp (day)16.7 °C 13.7–17.6

Min temp (night)8.20 °C 5.50–9.00

Precipitation83.6 mm/mo 72.1–131

Air humidity56.3 % 56.0–62.5

Moisture balance-29.2 mm/mo -35.6–26.4

Vapour deficit681 Pa 458–687

Wind speed2.40 m/s 2.00–3.40

Cloud cover50.0 % 40.6–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta cauta

At a glance

Sources8 archives

Morphometry1

Predation3

Ecology7

At a glance

Record type2 521 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 521 records