Agyneta olivacea

(Emerton, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records1 039

Data sources8

Biological traits1

DNA specimens65

eDNA detections65

Sources8 archives

Databases and archives Agyneta olivacea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 039 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

World Spider Trait DBMasaryk University1 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources1 traits

Occurrence & distributionGBIF1 039 records

Environmental DNA1 datasets · 4 countries65 detections

DNA & barcodingBOLD65 specimens

01Narrative

Agyneta olivacea is a species of sheet weaver found in the Holarctic. It was described by Emerton in 1882.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesHyvärinen et al. 2019Harvey et al. 2017Henriksen & Hilmo 2015SLU 2020

Ecology1

Regional IUCN Red List categoryLeast Concern (LC)

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta olivacea has left across the world's sequence archives.

At a glance

DNA specimens65

BINs1

Marker genes1

eDNA detections65

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

7Amostly conserved

92Tmostly conserved

184Cvariable

217Gmostly conserved

346Cvariable

475Tmostly conserved

541Amostly conserved

574Cmostly conserved

586Tmostly conserved

637Cvariable

AAGTTTATATTTTATTTTTGGAGCTTGAGCGGCTATAGTTGGTACTGCAATAAGAGTATTAATTCGAATTGAATTGGGTCAGACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair1.2%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta cautasame genus3.5%Agyneta bulavintsevisame genus7.3%Agyneta decorasame genus8.1%Agyneta subtilissame genus8.5%Agyneta trifurcatasame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 039 records

Wild obs. + sensor252

Museum / vouchered787

Range

Area of Occupancy AOO964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 228≤1 km 10≤10 km 14

252 georeferenced

Open the mapobservation + sensor252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 373≤1 km 69≤10 km 32>10 km 35

509 georeferenced · 278 without coordinates

Open the institutions mapphysical evidence787

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	230
Edmonton, CA	210
Ekaterinburg, RU	39
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	28
University of Guelph, Centre for Biodiversity Genomicslocation not on record	28
University of Alberta Museums (UAM)location not on record	25
SLU Artdatabankenlocation not on record	11
Cambridge, US	7
Rovaniemi, FI	7
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	6
Chicago, US	6
Denver, US	5
Frankfurt am Main	4
Espace pour la vielocation not on record	2
University of Oulu, Zoological Museumlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Uniwersytet w Białymstokulocation not on record	1

17 institutions · 613 of 787 vouchered records shown · 174 without an institution code

09Environmental DNA65 detections

Where the DNA of Agyneta olivacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map4 countries0

MesicForest1. Forest & Woodland | 1.1. Boreal Forestalpine tundraWetland4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 7.90–15.5

Seasonal swing summer↔winter34.5 °C

Max temp (day)17.2 °C 11.1–21.5

Min temp (night)8.10 °C 2.40–9.60

Precipitation69.8 mm/mo 45.8–96.9

Air humidity55.9 % 52.1–60.9

Moisture balance-50.0 mm/mo -85.9–-15.7

Vapour deficit608 Pa 454–840

Wind speed3.10 m/s 1.90–5.80

Cloud cover43.4 % 36.6–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta olivacea

At a glance

Sources8 archives

Ecology1

At a glance

Record type1 039 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 039 records