Agyneta subtilis

(O.Pickard-Cambridge, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agyneta

At a glance

Occurrence records2 016

Data sources8

Biological traits11

DNA specimens14

eDNA detections14

Sources8 archives

Databases and archives Agyneta subtilis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 016 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

World Spider Trait DBMasaryk University11 traits · 27 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements27 literature sources11 traits

Occurrence & distributionGBIF2 016 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agyneta subtilis is a species of sheet weaver found in the Palearctic. It was described by O.P.-Cambridge in 1863.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 27 sources

Schirmel et al. 2012Entling et al. 2007Buchar & Růžička 2002Staręga et al. 2001Gajdoš & Svatoň 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Gajdoš et al. 2014Hyvärinen et al. 2019Bruun & Lissner 2019SLU 2020Martin 2012Kielhorn 2017Finch 2004Maelfait et al. 1998Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Komposch & Steinberger 1999Blick & Scheidler 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.75·♂2.75 mm

Predation3

Hunting guildsheet web weavers

Simple hunting guild IIweb

Web buildingyes

Ecology7

Ballooningless common

Light0.5 mm

Light 2semi-open

Moisture 10.625 mm

Moisture 2very humid

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agyneta subtilis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 71 variable positions, in barcode order

1Gmostly conserved

31Amostly conserved

40Amostly conserved

43Tmostly conserved

46Gmostly conserved

49Amostly conserved

58Gmostly conserved

61Amostly conserved

79Tmostly conserved

88Gmostly conserved

100Tmostly conserved

127Amostly conserved

130Tmostly conserved

145Amostly conserved

163Gmostly conserved

169Amostly conserved

181Gmostly conserved

197Cmostly conserved

199Amostly conserved

202Cmostly conserved

211Amostly conserved

214Gmostly conserved

217Amostly conserved

229Amostly conserved

235Cmostly conserved

241Amostly conserved

247Cmostly conserved

251Cmostly conserved

253Tmostly conserved

262Amostly conserved

271Cmostly conserved

280Gmostly conserved

286Gmostly conserved

301Tmostly conserved

310Amostly conserved

316Gmostly conserved

322Amostly conserved

323Gmostly conserved

325Gmostly conserved

328Amostly conserved

337Gmostly conserved

343Cmostly conserved

347Cmostly conserved

364Gmostly conserved

373Amostly conserved

376Tmostly conserved

415Gmostly conserved

421Tmostly conserved

430Amostly conserved

469Amostly conserved

478Gmostly conserved

493Amostly conserved

496Amostly conserved

508Gmostly conserved

511Amostly conserved

514Amostly conserved

517Tmostly conserved

520Cmostly conserved

535Gmostly conserved

544Amostly conserved

556Tmostly conserved

559Gmostly conserved

562Amostly conserved

580Amostly conserved

604Gmostly conserved

619Tmostly conserved

622Gmostly conserved

634Tmostly conserved

641Cmostly conserved

643Tmostly conserved

655Amostly conserved

GAGTTTATATTTTATTTTTGGAGCTTGAGCAGCTATAGTAGGTACGGCAATAAGAGTGTTAATTCGAATTGAATTAGGTCAAACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes4

BIN1

Most divergent pair10.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agyneta allosubtilissame genus2.0%Agyneta ramosasame genus6.7%Agyneta trifurcatasame genus7.6%Agyneta bulavintsevisame genus7.8%Agyneta cautasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 016 records

Wild obs. + sensor715

Museum / vouchered1 297

Other4

Origin

Native61

Range

Area of Occupancy AOO2 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 263≤1 km 89≤10 km 352>10 km 1

705 georeferenced · 10 without coordinates

Open the mapobservation + sensor715

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 131≤1 km 562≤10 km 323>10 km 77

1 093 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence1 297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	872
Brussels, BE	119
NTNU-VMlocation not on record	80
Ekaterinburg, RU	54
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	28
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	22
SLU Artdatabankenlocation not on record	15
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	14
Tartu, EE	13
Uniwersytet w Białymstokulocation not on record	12
Tilburg, NL	6
Metsähallituslocation not on record	5
NHMOlocation not on record	4
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
Copenhagen, DK	4
Provincia di Livornolocation not on record	2
Bonn, DE	2
	2
University of Tokyo, Department of Zoologylocation not on record	1
Akademia Pomorska w Słupskulocation not on record	1
Staatliches Museum fur Naturkunde, Stuttgartlocation not on record	1
Rovaniemi, FI	1
Adam Mickiewicz University in Poznańlocation not on record	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1

24 institutions · 1 264 of 1 297 vouchered records shown · 33 without an institution code

09Environmental DNA14 detections

Where the DNA of Agyneta subtilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

FluÃtal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–13.6

Seasonal swing summer↔winter33.7 °C

Max temp (day)16.8 °C 16.8–16.9

Min temp (night)9.70 °C 8.20–9.70

Precipitation79.7 mm/mo 79.7–83.6

Air humidity63.3 % 56.0–63.3

Moisture balance6.50 mm/mo -32.0–6.50

Vapour deficit557 Pa 557–684

Wind speed2.30 m/s 2.30–3.40

Cloud cover50.9 % 50.9–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agyneta subtilis

At a glance

Sources8 archives

Morphometry1

Predation3

Ecology7

At a glance

Record type2 016 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 016 records