Agrotis munda

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records6 894

Data sources7

Biological traits0

DNA specimens322

eDNA detections327

Sources7 archives

Databases and archives Agrotis munda's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 894 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI327 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics322 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 894 records

Environmental DNA1 datasets · 4 countries327 detections

DNA & barcodingBOLD322 specimens

01Narrative

Agrotis munda, the brown cutworm or pink cutworm, is a noctuid moth. It is endemic to Australia. It is present in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding322 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis munda has left across the world's sequence archives.

At a glance

DNA specimens322

BINs2

Marker genes2

eDNA detections327

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus308 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

22Amostly conserved

121Amostly conserved

169Amostly conserved

199Amostly conserved

217Amostly conserved

235Tmostly conserved

274Tmostly conserved

337Gmostly conserved

343Cmostly conserved

346Amostly conserved

361Cmostly conserved

364Tmostly conserved

415Tmostly conserved

604Tmostly conserved

613Tmostly conserved

616Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 47 variants.

Diversity (π)0.54%

Haplotypes47

BINs2

Most divergent pair4.1%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis radianssame genus2.0%Agrotis striatasame genus2.4%Agrotis venerabilissame genus2.9%Agrotis vetustasame genus2.9%Agrotis ripaesame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_062121 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type6 894 records

Wild obs. + sensor5 275

Museum / vouchered504

Other1 115

Origin

Native37

Range

Area of Occupancy AOO7 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 2 468≤1 km 671≤10 km 222>10 km 522

3 883 georeferenced · 1 392 without coordinates

Open the mapobservation + sensor5 275

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 30≤1 km 4≤10 km 5

39 georeferenced · 465 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	179
Museums Victorialocation not on record	97
Tasmanian Museum & Art Gallerylocation not on record	30
Tallinn, EE	19
Natick, US	17
Australian National Fish Collectionlocation not on record	12
Auckland, NZ	5
ZSMlocation not on record	4
Helsinki, FI	3
MWLRlocation not on record	1
New Zealand Arthropod Collectionlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

12 institutions · 369 of 504 vouchered records shown · 135 without an institution code

09Environmental DNA327 detections

Where the DNA of Agrotis munda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found327

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 327 detections have coordinates

Open the map4 countries0

14. Artificial - Terrestrial|14.5 Urban AreasDry Sclerophyll Forest8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 10.9–23.6

Seasonal swing summer↔winter14.2 °C

Max temp (day)24.2 °C 14.6–29.8

Min temp (night)14.5 °C 7.00–20.9

Precipitation50.1 mm/mo 17.4–121

Air humidity56.4 % 46.5–61.6

Moisture balance-65.8 mm/mo

Vapour deficit1,009 Pa 555–1,530

Wind speed3.30 m/s

Cloud cover20.4 % 13.3–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 323 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis munda

At a glance

Sources7 archives

At a glance

Record type6 894 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 894 records