Agrotis radians

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records67

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Agrotis radians's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Agrotis radians (brown cutworm) is a moth of the family Noctuidae. It is found in the Australian Capital Territory, Queensland, New South Wales and Tasmania. Illustration The wingspan is about 40 mm. The larvae feed on Portulaca oleracea and a wide range of crops, such as Zea mays, Triticium, Nicotiana tabacum, Lycopersicon, Gossypium, Medicago sativum, Pinus and Pseudotsuga menziesii.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis radians has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 19 variable positions, in barcode order

31Cvariable

34Avariable

56Tvariable

82Tvariable

88Gvariable

97Tvariable

160Gvariable

268Cvariable

319Gvariable

379Tvariable

400Tvariable

451Cvariable

477Gvariable

506Gvariable

577Avariable

581Cvariable

622Avariable

646Tvariable

652Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAGTGGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis mundasame genus2.0%Agrotis embolomasame genus2.7%Agrotis venerabilissame genus3.0%Agrotis vetustasame genus3.3%Agrotis buchholzisame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor39

Museum / vouchered28

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 10≤1 km 2≤10 km 12

24 georeferenced · 15 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	21
Australian National Insect Collectionlocation not on record	2

2 institutions · 23 of 28 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Agrotis radians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 13.1–19.8

Seasonal swing summer↔winter14.0 °C

Max temp (day)21.7 °C 18.6–24.0

Min temp (night)11.5 °C 7.90–16.3

Precipitation59.6 mm/mo 40.9–81.6

Air humidity57.9 % 55.7–60.4

Moisture balance-48.4 mm/mo -61.1–-29.1

Vapour deficit831 Pa 631–956

Wind speed3.20 m/s 2.50–3.50

Cloud cover21.8 % 19.6–24.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)