Agrotis venerabilis

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records3 427

Data sources7

Biological traits0

DNA specimens173

eDNA detections174

Sources7 archives

Databases and archives Agrotis venerabilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI174 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics173 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 427 records

Environmental DNA1 datasets · 2 countries174 detections

DNA & barcodingBOLD173 specimens

01Narrative

Agrotis venerabilis, the dusky cutworm, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1857. It is found from coast to coast from central Canada south to Mexico. The wingspan is about 37 mm. Adults are on wing from August to September in temperate climes within their range. They have a much wider season in the Neotropics, starting at least as early as March. The larvae feed on Medicago sativa, Trifolium, Nicotiana tabacum, Viola, Stellaria media, Avena sativa and Zea mays.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding173 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis venerabilis has left across the world's sequence archives.

At a glance

DNA specimens173

BINs1

Marker genes1

eDNA detections174

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus169 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

340Cvariable

466Amostly conserved

472Avariable

553Amostly conserved

616Cmostly conserved

634Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes22

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis vetustasame genus1.5%Agrotis trifurcasame genus1.8%Agrotis buchholzisame genus2.0%Agrotis rileyanasame genus2.0%Agrotis chretienisame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 427 records

Wild obs. + sensor1 968

Museum / vouchered1 459

Range

Area of Occupancy AOO4 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 262≤1 km 231≤10 km 64>10 km 116

1 673 georeferenced · 295 without coordinates

Open the mapobservation + sensor1 968

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 121≤1 km 209≤10 km 313>10 km 47

690 georeferenced · 769 without coordinates

Open the institutions mapphysical evidence1 459

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	206
East Lansing, US	163
New Haven, US	147
St. Paul, US	140
Colorado State Universitylocation not on record	124
San Diego, US	111
King Saud Universitylocation not on record	70
University of Guelph, Centre for Biodiversity Genomicslocation not on record	52
Cleveland Museum of Natural History, OH (CLEV)location not on record	41
Royal Saskatchewan Museumlocation not on record	35
ASUlocation not on record	28
Oregon State Arthropod Collectionlocation not on record	19
Helsinki, FI	18
Mississippi State, US	15
Denver, US	13
CUlocation not on record	12
Cambridge, US	12
North Carolina State University Insect Museumlocation not on record	11
Vernal, US	10
Brussels, BE	9
US	7
Chicago, US	7
Decorah, US	7
Cornell University Insect Collectionlocation not on record	6
RBINS-Scientific Heritagelocation not on record	5
UDlocation not on record	4
OSUClocation not on record	4
Natural History Museum of Utahlocation not on record	4
SOVTlocation not on record	4
Albuquerque, US	2
Toronto, CA	2
WWUlocation not on record	2
Research Collection of Daniel Handfieldlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Awka, NG	1
München, DE	1

36 institutions · 1 294 of 1 459 vouchered records shown · 165 without an institution code

09Environmental DNA174 detections

Where the DNA of Agrotis venerabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found174

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 174 detections have coordinates

Open the map2 countries0

Temperate mixed forestMarshPinesGrassland1. Forest & Woodland|1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.7–17.9

Seasonal swing summer↔winter25.2 °C

Max temp (day)21.4 °C 19.0–22.9

Min temp (night)10.4 °C 7.40–15.2

Precipitation36.9 mm/mo 24.4–104

Air humidity55.4 % 53.1–61.9

Moisture balance-25.9 mm/mo -57.8–7.10

Vapour deficit795 Pa 653–868

Wind speed2.50 m/s 1.50–3.80

Cloud cover39.0 % 33.5–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 171 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis venerabilis

At a glance

Sources7 archives

At a glance

Record type3 427 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 427 records