Agrotis ripae

Hübner, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records12 642

Data sources8

Biological traits2

DNA specimens33

eDNA detections0

Sources8 archives

Databases and archives Agrotis ripae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 642 records↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF12 642 records

DNA & barcodingBOLD33 specimens

Genome at a glanceGoaT · NCBI≈953 Mbp

01Narrative

Agrotis ripae, the sand dart, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1823. It is found in western Europe and North Africa and extends east across the Palearctic to steppe areas in Russia, Mongolia and Siberia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis ripae has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

477Gmostly conserved

601Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes5

BIN1

Most divergent pair0.46%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis striatasame genus2.3%Agrotis vetustasame genus2.4%Agrotis venerabilissame genus2.6%Agrotis exclamationissame genus2.6%Agrotis gladiariasame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrotis ripae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈952 971 717 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrotis ripae0.95 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type12 642 records

Wild obs. + sensor9 266

Museum / vouchered3 355

Other21

Origin

Native34

Range

Area of Occupancy AOO4 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 707≤1 km 417≤10 km 7 129>10 km 72

8 325 georeferenced · 941 without coordinates

Open the mapobservation + sensor9 266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 1 020≤1 km 624≤10 km 1 568>10 km 1

3 213 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence3 355

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	3 141
Natural History Museum Rotterdamlocation not on record	30
SLU Artdatabankenlocation not on record	27
UMUlocation not on record	23
Tartu, EE	18
NHMOlocation not on record	17
Tallinn, EE	16
Helsinki, FI	15
Durban Natural Science Museumlocation not on record	15
Zürich, CH	11
NCMGlocation not on record	11
CBDClocation not on record	7
DABUHlocation not on record	3
Research Collection of Kai Berggrenlocation not on record	3
Podgorica, ME	2
Philadelphia, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
South Kensington, GB	2
Provincia di Livornolocation not on record	1
Nijmegen, NL	1
MZLUlocation not on record	1

21 institutions · 3 348 of 3 355 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis ripae

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type12 642 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Record type12 642 records