Agrilus salicis

Frivaldszky, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records95

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Agrilus salicis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Agrilus salicis é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Frivaldszky, 1877.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus salicis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

9Cvariable

15Avariable

CATAAAGACATTGGAACACTTTACTTTATTTTTGGAGCCTGATCAGGAATAGTAGGTACTGCACTTAGATTACTAATTCGAGCAGAGCTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pseudocorylisame genus13.2%Agrilus politussame genus13.8%Agrilus antiquussame genus13.9%Agrilus viridissame genus14.9%Agrilus hypericisame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor16

Museum / vouchered78

Other1

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 13 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 16>10 km 3

20 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	48
IFR-DNFlocation not on record	13
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	8
Geneva, CH	1

4 institutions · 70 of 78 vouchered records shown · 7 without an institution code

09Environmental DNA4 detections

Where the DNA of Agrilus salicis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C 5.90–13.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)9.70 °C 9.70–17.3

Min temp (night)1.10 °C 1.10–8.80

Precipitation82.6 mm/mo 69.0–82.6

Air humidity65.9 % 60.6–65.9

Moisture balance28.8 mm/mo -23.8–28.8

Vapour deficit370 Pa 370–657

Wind speed1.80 m/s 1.80–2.20

Cloud cover43.4 % 37.6–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)