Agrilus hyperici

(Creutzer, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records496

Data sources8

Biological traits0

DNA specimens13

eDNA detections15

Sources8 archives

Databases and archives Agrilus hyperici's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF496 records

Environmental DNA1 datasets · 6 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Agrilus hyperici, the St. John's wort root borer, is a species of jewel beetle. It is used as an agent of biological pest control against common St. John's wort (Hypericum perforatum) in areas where it is a noxious weed or invasive species.Biocontrol Info SheetCoombs, E. M., et al., Eds. (2004). Biological Control of Invasive Plants in the United States. Corvallis: Oregon State University Press, 324.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus hyperici has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections15

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

28Amostly conserved

34Avariable

40Gvariable

44Amostly conserved

52Cvariable

58Avariable

67Avariable

85Cvariable

100Amostly conserved

109Avariable

115Tvariable

121Cmostly conserved

143Amostly conserved

169Cvariable

172Cvariable

184Avariable

211Avariable

217Gmostly conserved

223Cvariable

241Amostly conserved

250Cmostly conserved

277Avariable

278Tvariable

287Cvariable

289Avariable

301Amostly conserved

304Avariable

310Gvariable

316Gvariable

328Gmostly conserved

346Cvariable

373Tvariable

376Tvariable

385Cvariable

407Cvariable

412Tvariable

415Avariable

418Cmostly conserved

427Cvariable

428Tvariable

436Tvariable

451Avariable

463Cvariable

475Avariable

511Gvariable

523Cvariable

538Amostly conserved

539Cvariable

562Tvariable

589Cmostly conserved

601Tvariable

616Tmostly conserved

625Amostly conserved

628Amostly conserved

634Cmostly conserved

649Gmostly conserved

AACCCTTTACTTTATTTTTGGGGCCTGATCAGGAATAGTGGGAACCGCTCTCAGATTATTAATTCGAGCAGAACTTGGAAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes6

BINs2

Most divergent pair7.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus ribesisame genus13.8%Agrilus pseudocorylisame genus14.0%Agrilus cuprescenssame genus14.3%Agrilus politussame genus14.6%Agrilus antiquussame genus15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type496 records

Wild obs. + sensor232

Museum / vouchered232

Other32

Origin

Native69

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 39≤1 km 37≤10 km 107>10 km 1

184 georeferenced · 48 without coordinates

Open the mapobservation + sensor232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 13≤10 km 127>10 km 10

150 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	30
Vernal, US	27
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	23
Bern, CH	18
Geneva, CH	7
Uniwersytet Wrocławskilocation not on record	7
Provincia di Livornolocation not on record	7
Muzeum Górnośląskie w Bytomiulocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
ZSMlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
DEIlocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Paro, BT	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
EJCBlocation not on record	1
Salzburg, AT	1
San Francisco, US	1
Brussels, BE	1
NTNU-VMlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
MZLUlocation not on record	1

24 institutions · 154 of 232 vouchered records shown · 75 without an institution code

09Environmental DNA15 detections

Where the DNA of Agrilus hyperici was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map6 countries0

Dry chalk grasslandShrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 9.60–20.9

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.2 °C 13.9–25.8

Min temp (night)12.4 °C 4.30–15.5

Precipitation64.2 mm/mo 33.4–82.6

Air humidity56.6 % 52.9–63.4

Moisture balance-61.7 mm/mo -122–13.6

Vapour deficit953 Pa 527–1,155

Wind speed2.40 m/s 1.80–3.40

Cloud cover35.3 % 34.1–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)