Agrilus ribesi

Schaefer, 1946 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records472

Data sources7

Biological traits0

DNA specimens16

eDNA detections14

Sources7 archives

Databases and archives Agrilus ribesi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF472 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD16 specimens

01Narrative

Agrilus ribesi é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Schaefer, 1946.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus ribesi has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes2

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)0.93%

Haplotypes2

BINs3

Most divergent pair2.1%

Where individuals differ — all 38 variable positions, in barcode order

79Amostly conserved

81Amostly conserved

143Amostly conserved

181Amostly conserved

202Tmostly conserved

214Amostly conserved

220Cmostly conserved

229Amostly conserved

238Cmostly conserved

241Gmostly conserved

250Tmostly conserved

265Amostly conserved

268Cmostly conserved

277Amostly conserved

280Gmostly conserved

298Amostly conserved

301Amostly conserved

307Amostly conserved

316Gmostly conserved

322Amostly conserved

373Gmostly conserved

376Cmostly conserved

388Amostly conserved

409Amostly conserved

412Amostly conserved

415Gmostly conserved

418Cmostly conserved

442Tmostly conserved

463Tmostly conserved

466Amostly conserved

523Cmostly conserved

529Amostly conserved

532Cmostly conserved

538Tmostly conserved

550Amostly conserved

556Gmostly conserved

646Cmostly conserved

652Cmostly conserved

AACACTTTACTTTATTTTTGGGGCCTGATCAGGAATAGTGGGTACCGCTCTTAGATTATTAATCCGAGCAGAACTTGGAAACCCCGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus cuprescenssame genus4.1%Agrilus suvorovisame genus5.0%Agrilus viridissame genus5.8%Agrilus paludicolasame genus6.6%Agrilus pseudocorylisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type472 records

Wild obs. + sensor395

Museum / vouchered77

Origin

Native10

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 282≤1 km 40≤10 km 40>10 km 9

371 georeferenced · 24 without coordinates

Open the mapobservation + sensor395

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 5≤1 km 1≤10 km 50

56 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
IFR-DNFlocation not on record	27
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	4
SLU Artdatabankenlocation not on record	4
Musee d'Histoire Naturallelocation not on record	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Geneva, CH	1
Helsinki, FI	1
Washington, US	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
MZLUlocation not on record	1

10 institutions · 44 of 77 vouchered records shown · 32 without an institution code

09Environmental DNA14 detections

Where the DNA of Agrilus ribesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 9.60–20.5

Seasonal swing summer↔winter31.1 °C

Max temp (day)23.7 °C 13.9–25.5

Min temp (night)13.6 °C 4.80–16.2

Precipitation74.3 mm/mo 73.7–80.5

Air humidity59.3 % 58.9–64.4

Moisture balance-64.6 mm/mo -68.2–6.20

Vapour deficit869 Pa 519–961

Wind speed2.80 m/s 2.00–2.90

Cloud cover43.2 % 42.7–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)