Agrilus suvorovi

Obenberger, 1935 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records845

Data sources8

Biological traits0

DNA specimens15

eDNA detections10

Sources8 archives

Databases and archives Agrilus suvorovi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility845 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF845 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD15 specimens

01Narrative

Agrilus suvorovi is a species of beetle in the family Buprestidae, the jewel beetles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus suvorovi has left across the world's sequence archives.

At a glance

DNA specimens15

BINs5

Marker genes2

eDNA detections10

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

5Cmostly conserved

18Amostly conserved

21Gmostly conserved

39Avariable

40Tmostly conserved

48Amostly conserved

57Cmostly conserved

69Gvariable

87Tmostly conserved

129Amostly conserved

132Cmostly conserved

153Cvariable

162Avariable

171Amostly conserved

177Amostly conserved

193Cmostly conserved

198Tvariable

231Tmostly conserved

243Gvariable

249Tvariable

252Tvariable

279Tvariable

282Avariable

297Gvariable

300Gmostly conserved

303Gvariable

321Tmostly conserved

348Tmostly conserved

411Avariable

423Cmostly conserved

438Amostly conserved

444Cvariable

447Gmostly conserved

456Gvariable

474Gmostly conserved

492Gmostly conserved

495Amostly conserved

519Tvariable

525Gvariable

531Amostly conserved

534Avariable

543Amostly conserved

558Avariable

561Amostly conserved

600Avariable

603Avariable

612Gvariable

618Tmostly conserved

GGGGCCTGATCAGGAATAGTGGGTACCGCTCTTAGATTATTAATCCGAGCAGAACTCGGAAACCCTGGGGCTTTAATTGGAAATGATCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes4

BINs4

Most divergent pair4.7%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus viridissame genus2.4%Agrilus paludicolasame genus3.5%Agrilus ribesisame genus5.0%Agrilus cuprescenssame genus5.2%Agrilus pseudocorylisame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type845 records

Wild obs. + sensor367

Museum / vouchered478

Origin

Native129

Range

Area of Occupancy AOO1 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 166≤1 km 78≤10 km 93

337 georeferenced · 30 without coordinates

Open the mapobservation + sensor367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 55≤1 km 86≤10 km 258

399 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence478

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	77
Muzeum Górnośląskie w Bytomiulocation not on record	45
Paro, BT	39
IFR-DNFlocation not on record	28
NTNU-VMlocation not on record	25
Musee d'Histoire Naturallelocation not on record	24
Trondheim, NO	23
Bern, CH	20
Olocation not on record	17
NHMOlocation not on record	12
Fribourg, CH	9
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Tallinn, EE	7
EJCBlocation not on record	5
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	5
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	4
Zürich, CH	4
Winterthur, CH	3
Sion, CH	2
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Tartu, EE	2
Adam Mickiewicz University in Poznańlocation not on record	2
MKCYlocation not on record	2
Geneva, CH	1
ZSMlocation not on record	1
Canadian Food Inspection Agency / Genotyping/Botanylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1
MZLUlocation not on record	1
Dhaka, BD	1

32 institutions · 375 of 478 vouchered records shown · 101 without an institution code

09Environmental DNA10 detections

Where the DNA of Agrilus suvorovi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 5.90–19.3

Seasonal swing summer↔winter20.4 °C

Max temp (day)12.7 °C 9.70–23.6

Min temp (night)5.00 °C 1.10–14.2

Precipitation68.3 mm/mo 45.7–82.6

Air humidity58.3 % 57.5–65.9

Moisture balance-20.6 mm/mo -79.1–28.8

Vapour deficit487 Pa 370–963

Wind speed2.60 m/s 1.50–4.20

Cloud cover40.9 % 37.1–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)