Agrilus pseudocoryli

Fisher, 1928 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records61

Data sources8

Biological traits0

DNA specimens7

eDNA detections5

Sources8 archives

Databases and archives Agrilus pseudocoryli's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agrilus pseudocoryli is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus pseudocoryli has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

22Gvariable

28Avariable

56Cvariable

118Tvariable

172Cvariable

196Avariable

211Gvariable

250Cvariable

265Avariable

268Cvariable

271Cvariable

290Tvariable

328Tvariable

412Gvariable

448Cmostly conserved

466Avariable

473Gvariable

475Avariable

550Avariable

565Avariable

577Amostly conserved

580Avariable

616Cvariable

619Avariable

625Avariable

634Tvariable

637Tvariable

AACACTTTACTTTATTTTTGGGGCCTGATCAGGAATGGTAGGCACTGCTCTTAGACTATTAATCCGAGCAGAACTTGGAAACCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes5

BINs3

Most divergent pair3.3%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus politussame genus2.6%Agrilus burkeisame genus3.6%Agrilus viridissame genus6.1%Agrilus cuprescenssame genus6.2%Agrilus suvorovisame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor1

Museum / vouchered60

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	45
St. Paul, US	12
Denver, US	1
Paris, FR	1

4 institutions · 59 of 60 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrilus pseudocoryli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 18.2–20.1

Seasonal swing summer↔winter30.4 °C

Max temp (day)25.1 °C 23.3–25.1

Min temp (night)15.8 °C 13.4–15.8

Precipitation98.2 mm/mo 96.2–98.2

Air humidity59.6 % 58.6–59.6

Moisture balance-49.5 mm/mo -49.5–-47.4

Vapour deficit950 Pa 866–950

Wind speed2.70 m/s 2.70–2.80

Cloud cover42.7 % 42.7–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)