Agrilus burkei

Fisher, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records89

Data sources8

Biological traits0

DNA specimens12

eDNA detections9

Sources8 archives

Databases and archives Agrilus burkei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agrilus burkei is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus burkei has left across the world's sequence archives.

At a glance

DNA specimens12

BINs4

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

12Amostly conserved

18Avariable

54Tvariable

63Cvariable

123Cvariable

148Amostly conserved

156Amostly conserved

159Gvariable

204Tvariable

240Amostly conserved

256Tmostly conserved

285Avariable

294Avariable

295Cvariable

300Gvariable

327Gvariable

330Avariable

354Tmostly conserved

450Cvariable

451Gmostly conserved

462Avariable

474Amostly conserved

516Tvariable

519Amostly conserved

555Gmostly conserved

561Cvariable

594Tmostly conserved

597Amostly conserved

606Gvariable

GCCTGATCAGGAATGGTAGGCACCGCTCTTAGACTATTAATTCGGGCAGAACTTGGAAACCCCGGGGCTTTAATTGGAAATGACCAAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes4

BINs2

Most divergent pair4.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pseudocorylisame genus3.6%Agrilus politussame genus5.0%Agrilus paludicolasame genus6.7%Agrilus viridissame genus6.8%Agrilus suvorovisame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor1

Museum / vouchered88

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 88 records without

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	53
San Francisco, US	24
Vernal, US	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

4 institutions · 85 of 88 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Agrilus burkei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 11.8–13.3

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 17.7–19.5

Min temp (night)8.20 °C 7.00–8.20

Precipitation79.6 mm/mo 64.7–80.4

Air humidity57.3 % 51.3–57.3

Moisture balance-38.4 mm/mo -69.7–-35.9

Vapour deficit733 Pa 688–796

Wind speed5.80 m/s 3.20–5.80

Cloud cover36.7 % 29.7–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)