Agrilus politus

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records671

Data sources10

Biological traits0

DNA specimens53

eDNA detections57

Sources10 archives

Databases and archives Agrilus politus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility671 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF671 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD53 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Agrilus politus, known generally as the willow gall limb borer or common willow agrilus, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus politus has left across the world's sequence archives.

At a glance

DNA specimens53

BINs8

Marker genes2

eDNA detections57

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

22Gmostly conserved

40Gmostly conserved

43Cmostly conserved

46Tmostly conserved

54Gmostly conserved

55Amostly conserved

64Cmostly conserved

67Amostly conserved

79Gmostly conserved

118Tvariable

124Tmostly conserved

136Tmostly conserved

145Tmostly conserved

148Amostly conserved

181Gmostly conserved

184Tmostly conserved

196Gvariable

211Amostly conserved

226Tmostly conserved

232Tmostly conserved

250Cmostly conserved

301Amostly conserved

307Gmostly conserved

316Avariable

328Tmostly conserved

352Gmostly conserved

364Tvariable

373Amostly conserved

448Tmostly conserved

469Amostly conserved

499Cvariable

511Gmostly conserved

538Cmostly conserved

550Gmostly conserved

565Avariable

571Tmostly conserved

577Gmostly conserved

580Gvariable

601Tmostly conserved

616Tvariable

622Amostly conserved

625Gmostly conserved

637Avariable

AACACTTTACTTTATTTTTGGGGCCTGATCAGGAATGGTGGGCACTGCTCTTAGACTATTAATCCGAGCAGAACTTGGGAACCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes7

BINs7

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pseudocorylisame genus2.6%Agrilus burkeisame genus5.0%Agrilus viridissame genus7.1%Agrilus cuprescenssame genus7.3%Agrilus paludicolasame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agrilus politus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Karagyan G, Kuznetsova KG (2000) Chromosome numbers and sex chromosome systems in buprestid beetles (Coleoptera, Buprestidae). Entomological Review 80: 38-49. ↗

08Occurrence & distribution

Record type671 records

Wild obs. + sensor27

Museum / vouchered644

Range

Area of Occupancy AOO1 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 14≤1 km 2≤10 km 1>10 km 1

18 georeferenced · 9 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 5≤1 km 26≤10 km 56>10 km 23

110 georeferenced · 534 without coordinates

Open the institutions mapphysical evidence644

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	175
San Francisco, US	87
University of Guelphlocation not on record	68
St. Paul, US	49
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	38
ASUlocation not on record	31
Lexington, US	27
Santa Barbara Museum of Natural Historylocation not on record	22
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	20
SOVTlocation not on record	12
Royal Saskatchewan Museumlocation not on record	11
San Diego, US	10
Universidad Católica de Manizaleslocation not on record	8
Edmonton, CA	8
University Park, US	6
Denver, US	5
Natural History Museum of Utahlocation not on record	5
University of Alberta Museums (UAM)location not on record	4
Colorado State Universitylocation not on record	4
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
OSUClocation not on record	2
Washington, US	2
Lubbock, US	2
Research Collection of E. Jendeklocation not on record	1
EJCBlocation not on record	1
University of Alaska Museumlocation not on record	1
WIlocation not on record	1
Espace pour la vielocation not on record	1
CUlocation not on record	1
University of Central Floridalocation not on record	1
US	1

31 institutions · 607 of 644 vouchered records shown · 30 without an institution code

09Environmental DNA57 detections

Where the DNA of Agrilus politus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

Grasslandsand barsRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 12.5–20.9

Seasonal swing summer↔winter30.4 °C

Max temp (day)23.7 °C 18.4–25.9

Min temp (night)13.9 °C 8.20–16.5

Precipitation80.7 mm/mo 75.5–122

Air humidity57.3 % 55.8–59.8

Moisture balance-39.5 mm/mo -69.8–-31.4

Vapour deficit914 Pa 733–1,045

Wind speed3.10 m/s 2.60–5.80

Cloud cover42.7 % 36.7–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)